MAP3K8 (NM_001244134) Human Untagged Clone

CAT#: SC332065

MAP3K8 (untagged) - Homo sapiens mitogen-activated protein kinase kinase kinase 8 (MAP3K8), transcript variant 2


  "NM_001244134" in other vectors (2)

Reconstitution Protocol

USD 470.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAP3K8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAP3K8
Synonyms AURA2; c-COT; COT; EST; ESTF; MEKK8; Tpl-2; TPL2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001244134, the custom clone sequence may differ by one or more nucleotides


ATGGAGTACATGAGCACTGGAAGTGACAATAAAGAAGAGATTGATTTATTAATTAAACATTTAAATGTGT
CTGATGTAATAGACATTATGGAAAATCTTTATGCAAGTGAAGAGCCAGCAGTTTATGAACCCAGTCTAAT
GACCATGTGTCAAGACAGTAATCAAAACGATGAGCGTTCTAAGTCTCTGCTGCTTAGTGGCCAAGAGGTA
CCATGGTTGTCATCAGTCAGATATGGAACTGTGGAGGATTTGCTTGCTTTTGCAAACCATATATCCAACA
CTGCAAAGCATTTTTATGGACAACGACCACAGGAATCTGGAATTTTATTAAACATGGTCATCACTCCCCA
AAATGGACGTTACCAAATAGATTCCGATGTTCTCCTGATCCCCTGGAAGCTGACTTACAGGAATATTGGT
TCTGATTTTATTCCTCGGGGCGCCTTTGGAAAGGTATACTTGGCACAAGATATAAAGACGAAGAAAAGAA
TGGCGTGTAAACTGATCCCAGTAGATCAATTTAAGCCATCTGATGTGGAAATCCAGGCTTGCTTCCGGCA
CGAGAACATCGCAGAGCTGTATGGCGCAGTCCTGTGGGGTGAAACTGTCCATCTCTTTATGGAAGCAGGC
GAGGGAGGGTCTGTTCTGGAGAAACTGGAGAGCTGTGGACCAATGAGAGAATTTGAAATTATTTGGGTGA
CAAAGCATGTTCTCAAGGGACTTGATTTTCTACACTCAAAGAAAGTGATCCATCATGATATTAAACCTAG
CAACATTGTTTTCATGTCCACAAAAGCTGTTTTGGTGGATTTTGGCCTAAGTGTTCAAATGACCGAAGAT
GTCTATTTTCCTAAGGACCTCCGAGGAACAGAGATTTACATGAGCCCAGAGGTCATCCTGTGCAGGGGCC
ATTCAACCAAAGCAGACATCTACAGCCTGGGGGCCACGCTCATCCACATGCAGACGGGCACCCCACCCTG
GGTGAAGCGCTACCCTCGCTCAGCCTATCCCTCCTACCTGTACATAATCCACAAGCAAGCACCTCCACTG
GAAGACATTGCAGATGACTGCAGTCCAGGGATGAGAGAGCTGATAGAAGCTTCCCTGGAGAGAAACCCCA
ATCACCGCCCAAGAGCCGCAGACCTACTAAAACATGAGGCCCTGAACCCGCCCAGAGAGGATCAGCCACG
CTGTCAGAGTCTGGACTCTGCCCTCTTGGAGCGCAAGAGGCTGCTGAGTAGGAAGGAGCTGGAACTTCCT
GAGAACATTGCTGATTCTTCGTGCACAGGAAGCACCGAGGAATCTGAGATGCTCAAGAGGCAACGCTCTC
TCTACATCGACCTCGGCGCTCTGGCTGGCTACTTCAATCTTGTTCGGGGACCACCAACGCTTGAATATGG
CTGA


Restriction Sites SgfI-MluI     
ACCN NM_001244134
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244134.1, NP_001231063.1
RefSeq Size 2782 bp
RefSeq ORF 1404 bp
Locus ID 1326
Cytogenetics 10p11.23
Protein Families Druggable Genome, Protein Kinase
Protein Pathways MAPK signaling pathway, T cell receptor signaling pathway, Toll-like receptor signaling pathway
Gene Summary 'This gene is an oncogene that encodes a member of the serine/threonine protein kinase family. The encoded protein localizes to the cytoplasm and can activate both the MAP kinase and JNK kinase pathways. This protein was shown to activate IkappaB kinases, and thus induce the nuclear production of NF-kappaB. This protein was also found to promote the production of TNF-alpha and IL-2 during T lymphocyte activation. This gene may also utilize a downstream in-frame translation start codon, and thus produce an isoform containing a shorter N-terminus. The shorter isoform has been shown to display weaker transforming activity. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]'
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. Variants 1-3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.