TIS11B (ZFP36L1) (NM_001244698) Human Untagged Clone

CAT#: SC332082

ZFP36L1 (untagged) - Homo sapiens ZFP36 ring finger protein-like 1 (ZFP36L1), transcript variant 2


  "NM_001244698" in other vectors (2)

Reconstitution Protocol

USD 350.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "ZFP36L1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZFP36L1
Synonyms Berg36; BRF1; cMG1; ERF-1; ERF1; RNF162B; TIS11B
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001244698, the custom clone sequence may differ by one or more nucleotides


ATGACCACCACCCTCGTGTCTGCCACCATCTTCGACTTGAGCGAAGTTTTATGCAAGGGTAACAAGATGC
TCAACTATAGTGCTCCCAGTGCAGGGGGTTGCCTGCTGGACAGAAAGGCAGTGGGCACCCCTGCTGGTGG
GGGCTTCCCTCGGAGGCACTCAGTCACCCTGCCCAGCTCCAAGTTCCACCAGAACCAGCTCCTCAGCAGC
CTCAAGGGTGAGCCAGCCCCCGCTCTGAGCTCGCGAGACAGCCGCTTCCGAGACCGCTCCTTCTCGGAAG
GGGGCGAGCGGCTGCTGCCCACCCAGAAGCAGCCCGGGGGCGGCCAGGTCAACTCCAGCCGCTACAAGAC
GGAGCTGTGCCGCCCCTTTGAGGAAAACGGTGCCTGTAAGTACGGGGACAAGTGCCAGTTCGCACACGGC
ATCCACGAGCTCCGCAGCCTGACCCGCCACCCCAAGTACAAGACGGAGCTGTGCCGCACCTTCCACACCA
TCGGCTTTTGCCCCTACGGGCCCCGCTGCCACTTCATCCACAACGCTGAAGAGCGCCGTGCCCTGGCCGG
GGCCCGGGACCTCTCCGCTGACCGTCCCCGCCTCCAGCATAGCTTTAGCTTTGCTGGGTTTCCCAGTGCC
GCTGCCACCGCCGCTGCCACCGGGCTGCTGGACAGCCCCACGTCCATCACCCCACCCCCTATTCTGAGCG
CCGATGACCTCCTGGGCTCACCTACCCTGCCCGATGGCACCAATAACCCTTTTGCCTTCTCCAGCCAGGA
GCTGGCAAGCCTCTTTGCCCCTAGCATGGGGCTGCCCGGGGGTGGCTCCCCGACCACCTTCCTCTTCCGG
CCCATGTCCGAGTCCCCTCACATGTTTGACTCTCCCCCCAGCCCTCAGGATTCTCTCTCGGACCAGGAGG
GCTACCTGAGCAGCTCCAGCAGCAGCCACAGTGGCTCAGACTCCCCGACCTTGGACAACTCAAGACGCCT
GCCCATCTTCAGCAGACTTTCCATCTCAGATGACTAA


Restriction Sites SgfI-MluI     
ACCN NM_001244698
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244698.1, NP_001231627.1
RefSeq Size 3170 bp
RefSeq ORF 1017 bp
Locus ID 677
Cytogenetics 14q24.1
Protein Families Transcription Factors
Gene Summary 'This gene is a member of the TIS11 family of early response genes, which are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. This gene is well conserved across species and has a promoter that contains motifs seen in other early-response genes. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]'
Transcript Variant: This variant (2) is alternatively spliced at the 3' end, and has a shorter 3' UTR compared to variant 1. Variants 1 and 2 encode the same isoform (1).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.