TIS11B (ZFP36L1) (NM_001244701) Human Untagged Clone

CAT#: SC332083

ZFP36L1 (untagged) - Homo sapiens ZFP36 ring finger protein-like 1 (ZFP36L1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZFP36L1
• Synonyms: Berg36; BRF1; cMG1; ERF-1; ERF1; RNF162B; TIS11B
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001244701, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGGAGGGCCCGGAAGTCGGGCCTGGGACAGAGGAGCCGGCCCACCGCCTCCCGGTCGGAAGCGGCAG
  TGCAGCCCGGAGTCAGAAAGGCGAGGGGCGCCGGGAACTGGCGTGTGGGACTCCAGACAGGAGAGGCTGC
  GCCTTCCCCGCACCGGGACCTTCGCGACACACCAGATCCTCGCCCCTGGCTCGCGCGAACGCACAGGATG
  ACCACCACCCTCGTGTCTGCCACCATCTTCGACTTGAGCGAAGTTTTATGCAAGGGTAACAAGATGCTCA
  ACTATAGTGCTCCCAGTGCAGGGGGTTGCCTGCTGGACAGAAAGGCAGTGGGCACCCCTGCTGGTGGGGG
  CTTCCCTCGGAGGCACTCAGTCACCCTGCCCAGCTCCAAGTTCCACCAGAACCAGCTCCTCAGCAGCCTC
  AAGGGTGAGCCAGCCCCCGCTCTGAGCTCGCGAGACAGCCGCTTCCGAGACCGCTCCTTCTCGGAAGGGG
  GCGAGCGGCTGCTGCCCACCCAGAAGCAGCCCGGGGGCGGCCAGGTCAACTCCAGCCGCTACAAGACGGA
  GCTGTGCCGCCCCTTTGAGGAAAACGGTGCCTGTAAGTACGGGGACAAGTGCCAGTTCGCACACGGCATC
  CACGAGCTCCGCAGCCTGACCCGCCACCCCAAGTACAAGACGGAGCTGTGCCGCACCTTCCACACCATCG
  GCTTTTGCCCCTACGGGCCCCGCTGCCACTTCATCCACAACGCTGAAGAGCGCCGTGCCCTGGCCGGGGC
  CCGGGACCTCTCCGCTGACCGTCCCCGCCTCCAGCATAGCTTTAGCTTTGCTGGGTTTCCCAGTGCCGCT
  GCCACCGCCGCTGCCACCGGGCTGCTGGACAGCCCCACGTCCATCACCCCACCCCCTATTCTGAGCGCCG
  ATGACCTCCTGGGCTCACCTACCCTGCCCGATGGCACCAATAACCCTTTTGCCTTCTCCAGCCAGGAGCT
  GGCAAGCCTCTTTGCCCCTAGCATGGGGCTGCCCGGGGGTGGCTCCCCGACCACCTTCCTCTTCCGGCCC
  ATGTCCGAGTCCCCTCACATGTTTGACTCTCCCCCCAGCCCTCAGGATTCTCTCTCGGACCAGGAGGGCT
  ACCTGAGCAGCTCCAGCAGCAGCCACAGTGGCTCAGACTCCCCGACCTTGGACAACTCAAGACGCCTGCC
  CATCTTCAGCAGACTTTCCATCTCAGATGACTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244701
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001244701.1, NP_001231630.1
• RefSeq Size: 3212 bp
• RefSeq ORF: 1224 bp
• Locus ID: 677
• Cytogenetics: 14q24.1
• Protein Families: Transcription Factors
• Gene Summary: 'This gene is a member of the TIS11 family of early response genes, which are induced by various agonists such as the phorbol ester TPA and the polypeptide mitogen EGF. This gene is well conserved across species and has a promoter that contains motifs seen in other early-response genes. The encoded protein contains a distinguishing putative zinc finger domain with a repeating cys-his motif. This putative nuclear transcription factor most likely functions in regulating the response to growth factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]'
  Transcript Variant: This variant (3) contains an additional exon at the 5' end compared to variant 1, that introduces an in-frame upstream AUG, translation from which results in an isoform (2) with a longer N-terminus compared to isoform 1.