NFIC (NM_001245005) Human Untagged Clone

CAT#: SC332116

NFIC (untagged) - Homo sapiens nuclear factor I/C (CCAAT-binding transcription factor) (NFIC), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NFIC
• Synonyms: CTF; CTF5; NF-I; NFI
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001245005, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATGAGTTCCACCCGTTCATCGAGGCCCTGCTGCCTCACGTCCGCGCCTTCGCCTACACCTGGTTCA
  ACCTGCAGGCGCGGAAGCGCAAGTACTTCAAGAAGCACGAGAAGCGGATGTCGAAGGACGAGGAGCGTGC
  GGTCAAGGACGAGCTGCTGGGCGAGAAGCCCGAGGTCAAGCAGAAGTGGGCGTCGCGGCTGCTGGCCAAG
  CTGCGCAAGGACATCCGGCCCGAGTGCCGCGAGGACTTCGTGCTGAGCATCACCGGCAAGAAGGCGCCGG
  GCTGCGTGCTCTCCAACCCCGACCAGAAGGGCAAGATGCGGCGCATCGACTGTCTCCGGCAGGCGGACAA
  GGTGTGGCGGCTGGACCTGGTCATGGTCATCCTGTTCAAGGGCATCCCGCTGGAGAGCACCGACGGCGAG
  CGCCTGGTCAAGGCTGCGCAGTGCGGTCACCCGGTCCTGTGCGTGCAGCCGCACCACATTGGCGTGGCCG
  TCAAGGAGCTGGACCTCTACCTGGCCTACTTCGTGCGTGAGCGAGATGCAGAGCAAAGCGGCAGTCCCCG
  GACAGGGATGGGCTCTGACCAGGAGGACAGCAAGCCCATCACGCTGGACACGACCGACTTCCAGGAGAGC
  TTTGTCACCTCCGGCGTGTTCAGCGTCACTGAGCTCATCCAAGTGTCCCGGACACCCGTGGTGACTGGAA
  CAGGACCCAACTTCTCCCTGGGGGAGCTGCAGGGGCACCTGGCATACGACCTGAACCCAGCCAGCACTGG
  CCTCAGAAGAACGCTGCCCAGCACCTCCTCCAGTGGGAGCAAGCGGCACAAATCGGGCTCGATGGAGGAA
  GACGTGGACACGAGCCCTGGCGGCGATTACTACACTTCGCCCAGCTCGCCCACGAGTAGCAGCCGCAACT
  GGACGGAGGACATGGAAGGAGGCATCTCGTCCCCGGTGAAGAAGACAGAGATGGACAAGTCACCATTCAA
  CAGCCCGTCCCCCCAGGACTCTCCCCGCCTCTCCAGCTTCACCCAGCACCACCGGCCCGTCATCGCCGTG
  CACAGCGGGATCGCCCGGAGCCCACACCCGTCCTCCGCTCTGCATTTCCCTACGACGTCCATCCTACCCC
  AGACGGCCTCCACCTACTTCCCCCACACGGCCATCCGCTACCCACCTCATCTCAACCCCCAGGACCCGCT
  CAAAGATCTTGTCTCGCTGGCCTGCGACCCAGCCAGCCAGCAACCTGGACCGCCTACTCTCCGCCCGACA
  CGTCCCCTGCAAACCGTTCCTTTGTGGGATTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001245005
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001245005.1, NP_001231934.1
• RefSeq Size: 7932 bp
• RefSeq ORF: 1293 bp
• Locus ID: 4782
• Cytogenetics: 19p13.3
• Protein Families: Transcription Factors
• Gene Summary: 'The protein encoded by this gene belongs to the CTF/NF-I family. These are dimeric DNA-binding proteins, and function as cellular transcription factors and as replication factors for adenovirus DNA replication. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]'
  Transcript Variant: This variant (4) contains an alternate 5' terminal exon, and lacks an exon in the 3' coding region (causing a frame-shift) compared to variant 1. This results in translation initiation from an alternate start codon, and a shorter isoform (4) with distinct N- and C- termini compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.