ADM2 (NM_001253845) Human Untagged Clone

CAT#: SC332240

ADM2 (untagged) - Homo sapiens adrenomedullin 2 (ADM2), transcript variant 2


  "NM_001253845" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ADM2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ADM2
Synonyms AM2; dJ579N16.4
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001253845, the custom clone sequence may differ by one or more nucleotides


ATGGCCCGGATCCCGACGGCCGCCCTGGGTTGCATCAGCCTCCTCTGCCTGCAGCTCCCTGGCTCGCTGT
CCCGCAGCCTGGGCGGGGACCCGCGACCCGTCAAACCCAGGGAGCCCCCAGCCCGGAGCCCTTCCAGCAG
CCTGCAGCCCAGGCACCCCGCACCCCGACCTGTGGTCTGGAAGCTTCACCGGGCCCTCCAGGCACAGAGG
GGTGCCGGCCTGGCCCCTGTTATGGGTCAGCCTCTCCGGGATGGTGGCCGCCAACACTCGGGCCCCCGAA
GACACTCGGGCCCCCGCAGGACCCAAGCCCAGCTCCTGCGAGTGGGCTGTGTGCTGGGCACCTGCCAGGT
GCAGAATCTCAGCCACCGCCTGTGGCAACTCATGGGACCGGCCGGCCGGCAGGACTCAGCTCCTGTGGAC
CCCAGCAGCCCCCACAGCTATGGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001253845
ORF Size 447 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001253845.1, NP_001240774.1
RefSeq Size 4045
RefSeq ORF 447
Locus ID 79924
Protein Families Druggable Genome, Secreted Protein
Gene Summary This gene encodes a member of the calcitonin gene-related peptide (CGRP)/calcitonin family of hormones that play a role in the regulation of cardiovascular homeostasis, prolactin release, anti-diuresis, anti-natriuresis, and regulation of food and water intake. The encoded protein is proteolytically processed to generate one or more biologically active peptides. [provided by RefSeq, Jul 2015]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.