TBC1D1 (NM_001253913) Human Untagged Clone

CAT#: SC332254

TBC1D1 (untagged) - Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TBC1D1
• Synonyms: TBC; TBC1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001253913, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGTGAGGAAGAGGCGTTTAAAATGCTCAAGTTTCTGATGTTTGACATGGGGCTGCGGAAACAGTATC
  GGCCAGACATGATTATTTTACAGATCCAGATGTACCAGCTCTCGAGGTTGCTTCATGATTACCACAGAGA
  CCTCTACAATCACCTGGAGGAGCACGAGATCGGCCCCAGCCTCTACGCTGCCCCCTGGTTCCTCACCATG
  TTTGCCTCACAGTTCCCGCTGGGATTCGTAGCCAGAGTCTTTGATATGATTTTTCTTCAGGGAACAGAGG
  TCATATTTAAAGTGGCTTTAAGTCTGTTGGGAAGCCATAAGCCCTTGATTCTGCAGCATGAAAACCTAGA
  AACCATAGTTGACTTTATAAAAAGCACGCTACCCAACCTTGGCTTGGTACAGATGGAAAAGACCATCAAT
  CAGGTATTTGAAATGGACATCGCTAAACAGTTACAAGCTTATGAAGTTGAGTACCACGTCCTTCAAGAAG
  AACTTATCGATTCCTCTCCTCTCAGTGACAACCAAAGAATGGATAAATTAGAGAAAACCAACAGCAGCTT
  ACGCAAACAGAACCTTGACCTCCTTGAACAGTTGCAGGTGGCAAATGGTAGGATCCAAAGCCTTGAGGCC
  ACCATTGAGAAGCTCCTGAGCAGTGAGAGCAAGCTGAAGCAGGCCATGCTTACCTTAGAACTGGAGCGGT
  CGGCCCTGCTGCAGACGGTGGAGGAGCTGCGGCGGCGGAGCGCAGAGCCCAGCGACCGGGAGCCTGAGTG
  CACGCAGCCCGAGCCCACGGGCGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253913
• ORF Size: 798 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001253913.1, NP_001240842.1
• RefSeq Size: 3344
• RefSeq ORF: 798
• Locus ID: 23216
• Protein Families: Druggable Genome
• Gene Summary: TBC1D1 is the founding member of a family of proteins sharing a 180- to 200-amino acid TBC domain presumed to have a role in regulating cell growth and differentiation. These proteins share significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]). [supplied by OMIM, Mar 2008]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a large portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants 3 and 4 encode the same isoform (3), which has a significantly shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.