TBC1D1 (NM_001253914) Human Untagged Clone

CAT#: SC332255

TBC1D1 (untagged) - Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 4


  "NM_001253914" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "TBC1D1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TBC1D1
Synonyms TBC; TBC1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001253914, the custom clone sequence may differ by one or more nucleotides


ATGAGTGAGGAAGAGGCGTTTAAAATGCTCAAGTTTCTGATGTTTGACATGGGGCTGCGGAAACAGTATC
GGCCAGACATGATTATTTTACAGATCCAGATGTACCAGCTCTCGAGGTTGCTTCATGATTACCACAGAGA
CCTCTACAATCACCTGGAGGAGCACGAGATCGGCCCCAGCCTCTACGCTGCCCCCTGGTTCCTCACCATG
TTTGCCTCACAGTTCCCGCTGGGATTCGTAGCCAGAGTCTTTGATATGATTTTTCTTCAGGGAACAGAGG
TCATATTTAAAGTGGCTTTAAGTCTGTTGGGAAGCCATAAGCCCTTGATTCTGCAGCATGAAAACCTAGA
AACCATAGTTGACTTTATAAAAAGCACGCTACCCAACCTTGGCTTGGTACAGATGGAAAAGACCATCAAT
CAGGTATTTGAAATGGACATCGCTAAACAGTTACAAGCTTATGAAGTTGAGTACCACGTCCTTCAAGAAG
AACTTATCGATTCCTCTCCTCTCAGTGACAACCAAAGAATGGATAAATTAGAGAAAACCAACAGCAGCTT
ACGCAAACAGAACCTTGACCTCCTTGAACAGTTGCAGGTGGCAAATGGTAGGATCCAAAGCCTTGAGGCC
ACCATTGAGAAGCTCCTGAGCAGTGAGAGCAAGCTGAAGCAGGCCATGCTTACCTTAGAACTGGAGCGGT
CGGCCCTGCTGCAGACGGTGGAGGAGCTGCGGCGGCGGAGCGCAGAGCCCAGCGACCGGGAGCCTGAGTG
CACGCAGCCCGAGCCCACGGGCGACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001253914
ORF Size 798 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001253914.1, NP_001240843.1
RefSeq Size 2990
RefSeq ORF 798
Locus ID 23216
Protein Families Druggable Genome
Gene Summary TBC1D1 is the founding member of a family of proteins sharing a 180- to 200-amino acid TBC domain presumed to have a role in regulating cell growth and differentiation. These proteins share significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]). [supplied by OMIM, Mar 2008]
Transcript Variant: This variant (4) differs in the 5' UTR, lacks a large portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants 3 and 4 encode the same isoform (3), which has a significantly shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.