TBC1D1 (NM_001253915) Human Untagged Clone
CAT#: SC332256
TBC1D1 (untagged) - Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 5
"NM_001253915" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TBC1D1 |
Synonyms | TBC; TBC1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001253915, the custom clone sequence may differ by one or more nucleotides
ATGATTTTTCTTCAGGGAACAGAGGTCATATTTAAAGTGGCTTTAAGTCTGTTGGGAAGCCATAAGCCCT TGATTCTGCAGCATGAAAACCTAGAAACCATAGTTGACTTTATAAAAAGCACGCTACCCAACCTTGGCTT GGTACAGATGGAAAAGACCATCAATCAGGTATTTGAAATGGACATCGCTAAACAGTTACAAGCTTATGAA GTTGAGTACCACGTCCTTCAAGAAGAACTTATCGATTCCTCTCCTCTCAGTGACAACCAAAGAATGGATA AATTAGAGAAAACCAACAGCAGCTTACGCAAACAGAACCTTGACCTCCTTGAACAGTTGCAGGTGGCAAA TGGTAGGATCCAAAGCCTTGAGGCCACCATTGAGAAGCTCCTGAGCAGTGAGAGCAAGCTGAAGCAGGCC ATGCTTACCTTAGAACTGGAGCGGTCGGCCCTGCTGCAGACGGTGGAGGAGCTGCGGCGGCGGAGCGCAG AGCCCAGCGACCGGGAGCCTGAGTGCACGCAGCCCGAGCCCACGGGCGACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001253915 |
ORF Size | 543 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001253915.1, NP_001240844.1 |
RefSeq Size | 2540 |
RefSeq ORF | 543 |
Locus ID | 23216 |
Protein Families | Druggable Genome |
Gene Summary | TBC1D1 is the founding member of a family of proteins sharing a 180- to 200-amino acid TBC domain presumed to have a role in regulating cell growth and differentiation. These proteins share significant homology with TRE2 (USP6; MIM 604334), yeast Bub2, and CDC16 (MIM 603461) (White et al., 2000 [PubMed 10965142]). [supplied by OMIM, Mar 2008] Transcript Variant: This variant (5) differs in the 5' UTR, lacks a large portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. The encoded isoform (4) has a significantly shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233376 | TBC1D1 (Myc-DDK tagged) - Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 5 |
USD 420.00 |
|
RG233376 | TBC1D1 (GFP-tagged) - Homo sapiens TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1 (TBC1D1), transcript variant 5 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review