RND3 (NM_001254738) Human Untagged Clone

CAT#: SC332265

RND3 (untagged) - Homo sapiens Rho family GTPase 3 (RND3), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RND3
• Synonyms: ARHE; memB; Rho8; RhoE
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001254738, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGAGAGAAGAGCCAGCCAGAAATTATCCAGCAAATCTATCATGGATCCTAATCAGAACGTGAAAT
  GCAAGATAGTTGTGGTGGGAGACAGTCAGTGTGGAAAAACTGCGCTGCTCCATGTCTTCGCCAAGGACTG
  CTTCCCCGAGAATTACGTTCCTACAGTGTTTGAGAATTACACGGCCAGTTTTGAAATCGACACACAAAGA
  ATAGAGTTGAGCCTGTGGGACACTTCGGGTTCTCCTTACTATGACAATGTCCGCCCCCTCTCTTACCCTG
  ATTCGGATGCTGTGCTGATTTGCTTTGACATCAGTAGACCAGAGACCCTGGACAGTGTCCTCAAAAAGTG
  GAAAGGTGAAATCCAGGAATTTTGTCCAAATACCAAAATGCTCTTGGTCGGCTGCAAGTCTGATCTGCGG
  ACAGATGTTAGTACATTAGTAGAGCTCTCCAATCACAGGCAGACGCCAGTGTCCTATGACCAGGGGGCAA
  ATATGGCCAAACAGATTGGAGCAGCTACTTATATCGAATGCTCAGCTTTACAGTCGGAAAATAGCGTCAG
  AGACATTTTTCACGTTGCCACCTTGGCATGTGTAAATAAGACAAATAAAAACGTTAAGCGGAACAAATCA
  CAGAGAGCCACAAAGCGGATTTCACACATGCCTAGCAGACCAGAACTCTCGGCAGTTGCTACGGACTTAC
  GAAAGGACAAAGCGAAGAGCTGCACTGTGATGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001254738
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001254738.1, NP_001241667.1
• RefSeq Size: 2807 bp
• RefSeq ORF: 735 bp
• Locus ID: 390
• Cytogenetics: 2q23.3
• Gene Summary: 'This gene encodes a protein which is a member of the small GTPase protein superfamily. The encoded protein binds only GTP but has no GTPase activity, and appears to act as a negative regulator of cytoskeletal organization leading to loss of adhesion. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]'
  Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.