PCGF5 (NM_001256549) Human Untagged Clone

CAT#: SC332416

PCGF5 (untagged) - Homo sapiens polycomb group ring finger 5 (PCGF5), transcript variant 2


  "NM_001256549" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "PCGF5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol PCGF5
Synonyms RNF159
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256549, the custom clone sequence may differ by one or more nucleotides


ATGGCTACCCAAAGGAAACACTTGGTGAAAGATTTTAATCCTTACATTACCTGCTATATCTGTAAAGGGT
ATCTGATCAAGCCAACAACAGTGACGGAATGCCTCCATACATTCTGTAAGACTTGTATTGTTCAGCACTT
TGAAGATAGCAATGATTGCCCAAGGTGTGGCAACCAAGTTCATGAGACAAATCCATTAGAAATGTTGAGG
TTGGACAATACATTAGAGGAAATTATATTTAAGCTGGTCCCTGGACTACGAGAACAAGAACTTGAGCGTG
AATCTGAATTTTGGAAGAAAAATAAGCCTCAAGAAAATGGACAAGATGATACTTCAAAAGCTGACAAACC
GAAAGTAGATGAAGAAGGTGATGAAAATGAAGATGATAAAGATTATCACAGAAGTGACCCACAAATTGCT
ATCTGTCTAGATTGTTTACGAAATAATGGGCAATCAGGGGACAATGTAGTAAAGGGTTTAATGAAGAAAT
TCATTCGATGTTCTACACGTGTAACTGTGGGAACTATTAAAAAATTTCTAAGTTTAAAACTAAAACTTCC
AAGTTCTTATGAGTTGGATGTGCTGTGCAATGGTGAAATTATGGGGAAGGATCATACTATGGAATTCATC
TACATGACAAGATGGCGACTAAGAGGCGAAAACTTTCGGTGTCTGAACTGCTCAGCTTCGCAAGTCTGCT
CTCAGGATGGCCCTTTGTATCAGTCATACCCTATGGTACTGCAGTATCGACCAAGAATTGATTTCGGTTA
G


Restriction Sites SgfI-MluI     
ACCN NM_001256549
ORF Size 771 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256549.1, NP_001243478.1
RefSeq Size 7164
RefSeq ORF 771
Locus ID 84333
Gene Summary Component of a Polycomb group (PcG) multiprotein PRC1-like complex, a complex class required to maintain the transcriptionally repressive state of many genes, including Hox genes, throughout development. PcG PRC1 complex acts via chromatin remodeling and modification of histones; it mediates monoubiquitination of histone H2A 'Lys-119', rendering chromatin heritably changed in its expressibility. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2 and 4 all encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.