DNase gamma (DNASE1L3) (NM_001256560) Human Untagged Clone

CAT#: SC332418

DNASE1L3 (untagged) - Homo sapiens deoxyribonuclease I-like 3 (DNASE1L3), transcript variant 2

Product Images

Circular map for SC332418

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DNase gamma
• Synonyms: DHP2; DNAS1L3; LSD; SLEB16
• Vector: pCMV6-Entry
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256560, the custom clone sequence may differ by one or more nucleotidesGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTCACGGGAGCTGGCCCCACTGCTGCTTCTCCTCCTCTCCATCCACAGCGCCCTGGCCATGAGGATC
  TGCTCCTTCAACGTCAGGTCCTTTGGGGAAAGCAAGCAGGAAGACAAGAATGCCATGGATGTCATTGTG
  AAGGTCATCAAACGCTGTGACATCATACTCGTGATGGAAATCAAGGACAGCAACAACAGGATCTGCCCC
  ATACTGATGGAGAAGCTGAACAGGGAAAAGCTGGTGTCTGTGAAGAGGAGTTATCACTACCATGACTAT
  CAGGATGGAGACGCAGATGTGTTTTCCAGGGAGCCCTTTGTGGTCTGGTTCCAATCTCCCCACACTGCT
  GTCAAAGACTTCGTGATTATCCCCCTGCACACCACCCCAGAGACATCCGTTAAGGAGATCGATGAGTTG
  GTTGAGGTCTACACGGACGTGAAACACCGCTGGAAGGCGGAGAATTTCATTTTCATGGGTGACTTCAAT
  GCCGGCTGCAGCTACGTCCCCAAGAAGGCCTGGAAGAACATCCGCTTGAGGACTGACCCCAGGTTTGTT
  TGGCTGATCGGGGACCAAGAGGACACCACGGTGAAGAAGAGCACCAACTGTGCATATGACAGGATTGTG
  CTTAGAGGACAAGAAATCGTCAGTTCTGTTGTTCCCAAGTCAAACAGTGTTTTTGACTTCCAGAAAGCT
  TACAAGCTGACTGAAGAGGAGGCCCTGGATGTCAGCGACCACTTTCCAGTTGAATTTAAACTACAGTCT
  TCAAGGGCCTTCACCAACAGCAAAAAATCTGTCACTCTAAGGAAGAAAACAAAGAGCAAACGCTCCTAG
  
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001256560
• Insert Size: 828 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256560.2
• RefSeq Size: 1324 bp
• RefSeq ORF: 828 bp
• Locus ID: 1776
• UniProt ID: Q13609
• Cytogenetics: 3p14.3
• Protein Families: Druggable Genome
• MW: 31.9 kDa
• Gene Summary: This gene encodes a member of the deoxyribonuclease I family. The encoded protein hydrolyzes DNA, is not inhibited by actin, and mediates the breakdown of DNA during apoptosis. Mutations in this gene are a cause of systemic lupus erythematosus-16. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
  Transcript Variant: This variant (2) lacks an exon in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.