LXR beta (NR1H2) (NM_001256647) Human Untagged Clone

CAT#: SC332434

NR1H2 (untagged) - Homo sapiens nuclear receptor subfamily 1, group H, member 2 (NR1H2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NR1H2
• Synonyms: LXR-b; LXRB; NER; NER-I; RIP15; UNR
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256647, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTCCTCTCCTACCACGAGTTCCCTGGATACCCCCCTGCCTGGAAATGGCCCCCCTCAGCCTGGCGCCC
  CTTCTTCTTCACCCACTGTAAAGGAGGAGGGTCCGGAGCCGTGGCCCGGGGGTCCGGACCCTGATGTCCC
  AGGCACTGATGAGGCCAGCTCAGCCTGCAGCACAGACTGGGGCGTCCTTTCTGAAGAACAGATCCGGAAG
  AAGAAGATTCGGAAACAACAGCAGCAGGAGTCACAGTCACAGTCGCAGTCACCTGTGGGGCCGCAGGGCA
  GCAGCAGCTCAGCCTCTGGGCCTGGGGCTTCCCCTGGTGGATCTGAGGCAGGCAGCCAGGGCTCCGGGGA
  AGGCGAGGGTGTCCAGCTAACAGCGGCTCAAGAACTAATGATCCAGCAGTTGGTGGCGGCCCAACTGCAG
  TGCAACAAACGCTCCTTCTCCGACCAGCCCAAAGTCACGCCCTGGCCCCTGGGCGCAGACCCCCAGTCCC
  GAGATGCCCGCCAGCAACGCTTTGCCCACTTCACGGAGCTGGCCATCATCTCAGTCCAGGAGATCGTGGA
  CTTCGCTAAGCAAGTGCCTGGTTTCCTGCAGCTGGGCCGGGAGGACCAGATCGCCCTCCTGAAGGCATCC
  ACTATCGAGATCATGCTGCTAGAGACAGCCAGGCGCTACAACCACGAGACAGAGTGTATCACCTTCTTGA
  AGGACTTCACCTACAGCAAGGACGACTTCCACCGTGCAGGCCTGCAGGTGGAGTTCATCAACCCCATCTT
  CGAGTTCTCGCGGGCCATGCGGCGGCTGGGCCTGGACGACGCTGAGTACGCCCTGCTCATCGCCATCAAC
  ATCTTCTCGGCCGACCGGCCCAACGTGCAGGAGCCGGGCCGCGTGGAGGCGTTGCAGCAGCCCTACGTGG
  AGGCGCTGCTGTCCTACACGCGCATCAAGAGGCCGCAGGACCAGCTGCGCTTCCCGCGCATGCTCATGAA
  GCTGGTGAGCCTGCGCACGCTGAGCTCTGTGCACTCGGAGCAGGTCTTCGCCTTGCGGCTCCAGGACAAG
  AAGCTGCCGCCTCTGCTGTCGGAGATCTGGGACGTCCACGAGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256647
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256647.1, NP_001243576.1
• RefSeq Size: 1802 bp
• RefSeq ORF: 1095 bp
• Locus ID: 7376
• Cytogenetics: 19q13.33
• Protein Families: Druggable Genome, Nuclear Hormone Receptor, Transcription Factors
• Gene Summary: 'The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010]'
  Transcript Variant: This variant (2) lacks an exon in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (2) is shorter than isoform 1. CCDS Note: The coding region was updated to make it identical to the current human reference genome sequence.