HNRPH1 (HNRNPH1) (NM_001257293) Human Untagged Clone

CAT#: SC332522

HNRNPH1 (untagged) - Homo sapiens heterogeneous nuclear ribonucleoprotein H1 (H) (HNRNPH1), transcript variant 1


  "NM_001257293" in other vectors (2)

Reconstitution Protocol

USD 460.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "HNRNPH1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol HNRNPH1
Synonyms hnRNPH; HNRPH; HNRPH1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001257293, the custom clone sequence may differ by one or more nucleotides


ATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGTGAAGGTCCGGGGCTTGCCCTGGTCTTGCTCGG
CCGATGAAGTGCAGAGGTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATCTA
CACCAGAGAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTGGCC
CTGAAAAAAGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGG
ATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGTACGGCTTAGAGG
ACTTCCCTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCAAATGGG
ATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACAGGAAA
TAGCTGAAAAGGCTCTAAAGAAACACAAGGAAAGAATAGGGCACAGGTATATTGAAATCTTTAAGAGCAG
TAGAGCTGAAGTTAGAACTCATTATGATCCACCACGAAAGCTTATGGCCATGCAGCGGCCAGGTCCTTAT
GACAGACCTGGGGCTGGTAGAGGGTATAACAGCATTGGCAGAGGAGCTGGCTTTGAGAGGATGAGGCGTG
GTGCTTATGGTGGAGGCTATGGAGGCTATGATGATTACAATGGCTATAATGATGGCTATGGATTTGGGTC
AGATAGATTTGGAAGAGACCTCAATTACTGTTTTTCAGGAATGTCTGATCACAGATACGGGGATGGTGGC
TCTACTTTCCAGAGCACAACAGGACACTGTGTACACATGCGGGGATTACCTTACAGAGCTACTGAGAATG
ACATTTATAATTTTTTTTCACCGCTCAACCCTGTGAGAGTACACATTGAAATTGGTCCTGATGGCAGAGT
AACTGGTGAAGCAGATGTCGAGTTCGCAACTCATGAAGATGCTGTGGCAGCTATGTCAAAAGACAAAGCA
AATATGCAACACAGATATGTAGAACTCTTCTTGAATTCTACAGCAGGAGCAAGCGGTGGTGCTTACGAAC
ACAGATATGTAGAACTCTTCTTGAATTCTACAGCAGGAGCAAGCGGTGGTGCTTATGGTAGCCAAATGAT
GGGAGGCATGGGCTTGTCAAACCAGTCCAGCTACGGGGGCCCAGCCAGCCAGCAGCTGAGTGGGGGTTAC
GGAGGCGGCTACGGTGGCCAGAGCAGCATGAGTGGATACGACCAAGTTTTACAGGAAAACTCCAGTGATT
TTCAATCAAACATTGCATAG


Restriction Sites SgfI-MluI     
ACCN NM_001257293
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001257293.1, NP_001244222.1
RefSeq Size 2304 bp
RefSeq ORF 1350 bp
Locus ID 3187
Cytogenetics 5q35.3
Gene Summary 'This gene encodes a member of a subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins that complex with heterogeneous nuclear RNA. These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some may shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has three repeats of quasi-RRM domains that bind to RNA and is very similar to the family member HNRPF. This gene may be associated with hereditary lymphedema type I. Alternatively spliced transcript variants have been described [provided by RefSeq, Mar 2012]'
Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). Variants 1 and 2 both encode the same isoform (a).

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.