Beta Arrestin 2 (ARRB2) (NM_001257330) Human Untagged Clone
CAT#: SC332527
ARRB2 (untagged) - Homo sapiens arrestin, beta 2 (ARRB2), transcript variant 5
"NM_001257330" in other vectors (2)
Product Images
Other products for "ARRB2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | ARRB2 |
Synonyms | ARB2; ARR2; BARR2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001257330, the custom clone sequence may differ by one or more nucleotides
ATGGGGGAGAAACCCGGGACCAGGGTCTTCAAGAAGTCGAGCCCTAACTGCAAGCTCACCGTGTACTTGG GCAAGCGGGACTTCGTAGATCACCTGGACAAAGTGGACCCTGTAGATGGCGTGGTGCTTGTGGACCCTGA CTACCTGAAGGACCGCAAAGTGTTTGTGACCCTCACCTGCGCCTTCCGCTATGGCCGTGAAGACCTGGAT GTGCTGGGCTTGTCCTTCCGCAAAGACCTGTTCATCGCCACCTACCAGGCCTTCCCCCCGGTGCCCAACC CACCCCGGCCCCCCACCCGCCTGCAGGACCGGCTGCTGAGGAAGCTGGGCCAGCATGCCCACCCCTTCTT CTTCACCATACCCCAGAATCTTCCATGCTCCGTCACACTGCAGCCAGGCCCAGAGGATACAGGAAAGGCC TGCGGCGTAGACTTTGAGATTCGAGCCTTCTGTGCTAAATCACTAGAAGAGAAAAGCCACAAAAGGAACT CTGTGCGGCTGGTGATCCGAAAGGTGCAGTTCGCCCCGGAGAAACCCGGCCCCCAGCCTTCAGCCGAAAC CACACGCCACTTCCTCATGTCTGACCGGTCCCTGCACCTCGAGGCTTCCCTGGACAAGGAGCTGTACTAC CATGGGGAGCCCCTCAATGTAAATGTCCACGTCACCAACAACTCCACCAAGACCGTCAAGAAGATCAAAG TCTCTGTGAGACAGTACGCCGACATCTGCCTCTTCAGCACCGCCCAGTACAAGTGTCCTGTGGCTCAACT CGAACAAGATGACCAGGTATCTCCCAGCTCCACATTCTGTAAGGTGTACACCATAACCCCACTGCTCAGC GACAACCGGGAGAAGCGGGGTCTCGCCCTGGATGGGAAACTCAAGCACGAGGACACCAACCTGGCTTCCA GCACCATCGTGAAGGAGGGTGCCAACAAGGAGGTGCTGGGAATCCTGGTGTCCTACAGGGTCAAGGTGAA GCTGGTGGTGTCTCGAGGCGGGGATGTCTCTGTGGAGCTGCCTTTTGTTCTTATGCACCCCAAGCCCCAC GACCACATCCCCCTCCCCAGACCCCAGTCAGCACCCACCCCCACACCCCCTCTTCCCGTCCCCCCAGCCG CTCCGGAGACAGATGTCCCTGTGGACACCAACCTCATTGAATTTGATACCAACTATGCCACAGATGATGA CATTGTGTTTGAGGACTTTGCCCGGCTTCGGCTGAAGGGGATGAAGGATGACGACTATGATGATCAACTC TGCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001257330 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001257330.1, NP_001244259.1 |
RefSeq Size | 1972 bp |
RefSeq ORF | 1266 bp |
Locus ID | 409 |
Cytogenetics | 17p13.2 |
Protein Families | Druggable Genome |
Protein Pathways | Chemokine signaling pathway, Endocytosis, MAPK signaling pathway, Olfactory transduction |
Gene Summary | 'Members of arrestin/beta-arrestin protein family are thought to participate in agonist-mediated desensitization of G-protein-coupled receptors and cause specific dampening of cellular responses to stimuli such as hormones, neurotransmitters, or sensory signals. Arrestin beta 2, like arrestin beta 1, was shown to inhibit beta-adrenergic receptor function in vitro. It is expressed at high levels in the central nervous system and may play a role in the regulation of synaptic receptors. Besides the brain, a cDNA for arrestin beta 2 was isolated from thyroid gland, and thus it may also be involved in hormone-specific desensitization of TSH receptors. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2012]' Transcript Variant: This variant (5) uses an alternate in-frame splice junction at the 3' end of an exon and uses an alternate in-frame splice junction at the 5' end of another exon compared to variant 3. The resulting isoform (5) lacks an alternate internal segment and contains another alternate internal segment compared to isoform 3. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.