BLNK (NM_001258442) Human Untagged Clone
CAT#: SC332712
BLNK (untagged) - Homo sapiens B-cell linker (BLNK), transcript variant 5
"NM_001258442" in other vectors (2)
Product Images
Other products for "BLNK"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | BLNK |
Synonyms | AGM4; BASH; bca; BLNK-S; LY57; SLP-65; SLP65 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001258442, the custom clone sequence may differ by one or more nucleotides
ATGGACAAGCTTAATAAAATAACCGTCCCCGCCAGTCAGAAGTTGAGGCAGCTTCAAAAGATGGTCCATG ATATTAAAAACAATGAAGGTGGAATAATGAATAAAATCAAAAAGCTAAAAGTCAAAGCACCTCCAAGTGT TCCTCGAAGGGACTACGCTTCAGAGAGCCCTGCTGACGAAGAGGAGCAGTGGTCCGATGACTTTGACAGC GACTATGAAAATCCAGATGAGCACTCGGACTCAGAGATGTACGTGATGCCCGCCGAGGAGAACGCTGATG ACAGCTACGAGCCGCCTCCAGTAGAGCAGGAAACCAGGCCGGTTCACCCAGCCCTGCCCTTCGCCAGAGG AACAGCTTCAGGTCGAAACAGTGGGGCCTGGGAAACCAAGTCACCTCCACCAGCTGCACCATCCCCGTTG CCACGGGCCGGGAAAAAACCAACGACACCACTGAAGACAACTCCAGTTGCCTCTCAACAGAATGCTTCAA GTGTTTGTGAAGAAAAACCTATACCTGCTGAACGCCACCGAGGGTCAAGTCACAGACAAGAAGCTGTGCA GTCACCAGTGTTTCCTCCTGCCCAGAAACAAATCCACCAAAAACCCATACCTCTGCCAAGATTTACAGAA GGGGGAAACCCAACTGTGGATGGGCCCCTACCCAGCTTTTCATCTAATTCCACTATTTCAGAACAGGAAG CTGGCGTTCTCTGCAAGCCATGGTATGCTGGAGCCTGTGATCGAAAGTCTGCTGAAGAGGCATTGCACAG ATCAAACAAGTACTTTGGAAGTGTTGCTGAAATCATCAGGAATCATCAACATAGTCCTTTGGTTCTTATT GACAGTCAGAATAACACAAAAGATTCCACCAGACTGAAGTATGCAGTTAAAGTTTCATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001258442 |
ORF Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001258442.1, NP_001245371.1 |
RefSeq Size | 1298 |
RefSeq ORF | 900 |
Locus ID | 29760 |
Protein Families | Druggable Genome |
Protein Pathways | B cell receptor signaling pathway, Primary immunodeficiency |
Gene Summary | This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012] Transcript Variant: This variant (5) lacks 3 in-frame exons in the mid- and 3' coding regions, and uses alternate in-frame donor and acceptor splice sites compared to variant 1, resulting in a shorter isoform (5) compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.