WDR4 (NM_001260476) Human Untagged Clone

CAT#: SC332729

WDR4 (untagged) - Homo sapiens WD repeat domain 4 (WDR4), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: WDR4
• Synonyms: GAMOS6; MIGSB; TRM82; TRMT82
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001260476, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTGTTAGATGTGGCTGTGAGTCCTGATGACCGCTTCATCCTCACTGCCGACCGGGACGAGAAGATCC
  GAGTCAGCTGGGCCGCGGCGCCCCATAGCATCGAGTCCTTCTGCTTGGGGCACACAGAGTTTGTGAGCCG
  TATCTCCGTGGTGCCAACTCAGCCCGGGCTGCTTCTGTCCTCCTCTGGGGACGGCACCCTGAGGCTCTGG
  GAGTACAGGAGCGGCCGCCAGCTGCACTGCTGTCACCTGGCCAGTCTGCAGGAGCTGGTGGACCCCCAGG
  CCCCCCAGAAGTTTGCCGCGTCCAGGATTGCATTCTGGTGCCAGGAGAACTGCGTGGCGCTCCTGTGCGA
  CGGCACTCCTGTGGTCTACATCTTCCAGCTGGACGCCCGCAGACAGCAGTTGGTGTACAGGCAGCAGCTG
  GCGTTCCAGCACCAAGTGTGGGACGTGGCTTTCGAGGAGACCCAGGGGCTGTGGGTGCTCCAGGACTGCC
  AGGAAGCCCCCCTGGTGCTCTACAGGCCTGTGGGCGACCAGTGGCAGTCTGTTCCTGAGAGCACCGTGTT
  AAAGAAAGTCTCTGGTGTTCTTCGTGGGAACTGGGCCATGCTGGAAGGCTCTGCCGGCGCAGACGCCAGC
  TTCAGCAGTCTCTACAAGGCCACGTTCGACAACGTGACCTCCTACCTGAAGAAGAAAGAGGAGAGACTGC
  AGCAGCAGCTAGAGAAGAAGCAGCGGCGCCGGAGTCCCCCGCCTGGGCCCGACGGGCATGCCAAGAAGAT
  GAGACCGGGGGAGGCGACGCTAAGTTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001260476
• ORF Size: 801 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001260476.1, NP_001247405.1
• RefSeq Size: 2016
• RefSeq ORF: 801
• Locus ID: 10785
• Gene Summary: This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is excluded as a candidate for a form of nonsyndromic deafness (DFNB10), but is still a candidate for other disorders mapped to 21q22.3 as well as for the development of Down syndrome phenotypes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
  Transcript Variant: This variant (5) uses alternate donor splice sites at the 5' terminal exon and at another exon in the 5' region compared to variant 1, resulting in translation initiation from an in-frame downstream AUG and an isoform (3) with a shorter N-terminus compared to isoform 1. Variants 4-6 encode the same isoform.