WDR4 (NM_001260477) Human Untagged Clone

CAT#: SC332730

WDR4 (untagged) - Homo sapiens WD repeat domain 4 (WDR4), transcript variant 6


  "NM_001260477" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "WDR4"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol WDR4
Synonyms GAMOS6; MIGSB; TRM82; TRMT82
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001260477, the custom clone sequence may differ by one or more nucleotides


ATGCTGTTAGATGTGGCTGTGAGTCCTGATGACCGCTTCATCCTCACTGCCGACCGGGACGAGAAGATCC
GAGTCAGCTGGGCCGCGGCGCCCCATAGCATCGAGTCCTTCTGCTTGGGGCACACAGAGTTTGTGAGCCG
TATCTCCGTGGTGCCAACTCAGCCCGGGCTGCTTCTGTCCTCCTCTGGGGACGGCACCCTGAGGCTCTGG
GAGTACAGGAGCGGCCGCCAGCTGCACTGCTGTCACCTGGCCAGTCTGCAGGAGCTGGTGGACCCCCAGG
CCCCCCAGAAGTTTGCCGCGTCCAGGATTGCATTCTGGTGCCAGGAGAACTGCGTGGCGCTCCTGTGCGA
CGGCACTCCTGTGGTCTACATCTTCCAGCTGGACGCCCGCAGACAGCAGTTGGTGTACAGGCAGCAGCTG
GCGTTCCAGCACCAAGTGTGGGACGTGGCTTTCGAGGAGACCCAGGGGCTGTGGGTGCTCCAGGACTGCC
AGGAAGCCCCCCTGGTGCTCTACAGGCCTGTGGGCGACCAGTGGCAGTCTGTTCCTGAGAGCACCGTGTT
AAAGAAAGTCTCTGGTGTTCTTCGTGGGAACTGGGCCATGCTGGAAGGCTCTGCCGGCGCAGACGCCAGC
TTCAGCAGTCTCTACAAGGCCACGTTCGACAACGTGACCTCCTACCTGAAGAAGAAAGAGGAGAGACTGC
AGCAGCAGCTAGAGAAGAAGCAGCGGCGCCGGAGTCCCCCGCCTGGGCCCGACGGGCATGCCAAGAAGAT
GAGACCGGGGGAGGCGACGCTAAGTTGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001260477
ORF Size 801 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001260477.1, NP_001247406.1
RefSeq Size 2223
RefSeq ORF 801
Locus ID 10785
Gene Summary This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is excluded as a candidate for a form of nonsyndromic deafness (DFNB10), but is still a candidate for other disorders mapped to 21q22.3 as well as for the development of Down syndrome phenotypes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (6) contains an alternate 5' terminal exon and uses an alternate donor splice site at an exon in the 5' region compared to variant 1, resulting in translation initiation from an in-frame downstream AUG and an isoform (3) with a shorter N-terminus compared to isoform 1. Variants 4-6 encode the same isoform.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.