LAT2 (SLC7A8) (NM_001267037) Human Untagged Clone

CAT#: SC332832

SLC7A8 (untagged) - Homo sapiens solute carrier family 7 (amino acid transporter light chain, L system), member 8 (SLC7A8), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC7A8
• Synonyms: LAT2; LPI-PC1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001267037, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGTCAACTGTTCCAGTGTGCGGTGGGCCACCCGGGTTCAAGACATCTTCACAGCTGGGAAGCTCCTG
  GCCTTGGCCCTGATTATCATCATGGGGATTGTACAGATATGCAAAGGAACCTTCCCAGAGCCATCTTCAT
  CTCCATCCCACTGGTCACATTTGTGTATGTCTTTGCCAATGTCGCTTATGTCACTGCAATGTCCCCCCAG
  GAGCTGCTGGCATCCAACGCCGTCGCTGTGACTTTTGGAGAGAAGCTCCTAGGAGTCATGGCCTGGATCA
  TGCCCATTTCTGTTGCCCTGTCCACATTTGGAGGAGTTAATGGGTCTCTCTTCACCTCCTCTCGGCTGTT
  CTTCGCTGGAGCCCGAGAGGGCCACCTTCCCAGTGTGTTGGCCATGATCCACGTGAAGCGCTGCACCCCA
  ATCCCAGCCCTGCTCTTCACATGCATCTCCACCCTGCTGATGCTGGTCACCAGCGACATGTACACACTCA
  TCAACTATGTGGGCTTCATCAACTACCTCTTCTATGGGGTCACGGTTGCTGGACAGATAGTCCTTCGCTG
  GAAGAAGCCTGATATCCCCCGCCCCATCAAGATCAACCTGCTGTTCCCCATCATCTACTTGCTGTTCTGG
  GCCTTCCTGCTGGTCTTCAGCCTGTGGTCAGAGCCGGTGGTGTGTGGCATTGGCCTGGCCATCATGCTGA
  CAGGAGTGCCTGTCTATTTCCTGGGTGTTTACTGGCAACACAAGCCCAAGTGTTTCAGTGACTTCATTGA
  GCTGCTAACCCTGGTGAGCCAGAAGATGTGTGTGGTCGTGTACCCCGAGGTGGAGCGGGGCTCAGGGACA
  GAGGAGGCTAATGAGGACATGGAGGAGCAGCAGCAGCCCATGTACCAACCCACTCCCACGAAGGACAAGG
  ACGTGGCGGGGCAGCCCCAGCCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001267037
• ORF Size: 936 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001267037.1, NP_001253966.1
• RefSeq Size: 3041
• RefSeq ORF: 936
• Locus ID: 23428
• Protein Families: Druggable Genome, Transmembrane
• Gene Summary: Sodium-independent, high-affinity transport of small and large neutral amino acids such as alanine, serine, threonine, cysteine, phenylalanine, tyrosine, leucine, arginine and tryptophan, when associated with SLC3A2/4F2hc. Acts as an amino acid exchanger. Has higher affinity for L-phenylalanine than LAT1 but lower affinity for glutamine and serine. L-alanine is transported at physiological concentrations. Plays a role in basolateral (re)absorption of neutral amino acids. Involved in the uptake of methylmercury (MeHg) when administered as the L-cysteine or D,L-homocysteine complexes, and hence plays a role in metal ion homeostasis and toxicity. Involved in the cellular activity of small molecular weight nitrosothiols, via the stereoselective transport of L-nitrosocysteine (L-CNSO) across the transmembrane. Plays an essential role in the reabsorption of neutral amino acids from the epithelial cells to the bloodstream in the kidney. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (4) differs in the 5' UTR, lacks a portion of the 5' coding region, initiates translation at an alternate start codon and lacks an exon in the coding region, compared to variant 1. The encoded isoform (d) is shorter and has a distinct N-terminus, compared to isoform a.