Junctional Adhesion Molecule 2 (JAM2) (NM_001270408) Human Untagged Clone

CAT#: SC332925

JAM2 (untagged) - Homo sapiens junctional adhesion molecule 2 (JAM2), transcript variant 3


  "NM_001270408" in other vectors (2)

Reconstitution Protocol

USD 320.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "JAM2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol JAM2
Synonyms C21orf43; CD322; JAM-B; JAMB; PRO245; VE-JAM; VEJAM
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270408, the custom clone sequence may differ by one or more nucleotides


ATGGCGAGGAGGAGCCGCCACCGCCTCCTCCTGCTGCTGCTGCGCTACCTGGTGGTCGCCCTGGGCTATC
ATAAGGCCTATGGGTTTTCTGCCCCAAAAGACCAACAAGTAGTCACAGCAGTAGAGTACCAAGAGGCTAT
TTTAGCCTGCAAAACCCCAAAGAAGACTGTTTCCTCCAGATTAGAGTGGAAGAAACTGGGTCGGAGTGTC
TCCTTTGTCTACTATCAACAGACTCTTCAAGGTGATTTTAAAAATCGAGCTGAGATGATAGATTTCAATA
TCCGGATCAAAAATGTGACAAGAAGTGATGCGGGGAAATATCGTTGTGAAGTTAGTGCCCCATCTGAGCA
AGGCCAAAACCTGGAAGAGGATACAGTCACTCTGGAAGTATTAGTGGCTCCAGCAGTTCCATCATGTGAA
GTACCCTCTTCTGCTCTGAGTGGAACTGTGGTAGAGCTACGATGTCAAGACAAAGAAGGGAATCCAGCTC
CTGAATACACATGGTTTAAGGATGGCATCCGTTTGCTAGAAAATCCCAGACTTGGCTCCCAAAGCACCAA
CAGCTCATACACAATGAATACAAAAACTGGAACTCTGCAATTTAATACTGTTTCCAAACTGGACACTGGA
GAATATTCCTGTGAAGCCCGCAATTCTGTTGGATATCGCAGGTGTCCTGGGAAACGAATGCAAGTAGATG
ATCTCAACATAAGTGGCATCATAGCAGCCGTAGTAGTTGTGGCCTTAGTGATTTCCGTTTGTGGCCTTGG
TGTATGCTATGCTCAGAGGAAAGGCTACTTTTCAAAAGAAACCTCCTTCCAGAAGAGTAATTCTTCATCT
AAAGCCACGACAATGAGTGAAAATGTGCAGTGGCTCACGCCTGTAATCCCAGCACTTTGGAAGGCCGCGG
CGGGCGGATCACGAGGTCAGGAGTTCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001270408
ORF Size 939 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001270408.1, NP_001257337.1
RefSeq Size 1747
RefSeq ORF 939
Locus ID 58494
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs), Epithelial cell signaling in Helicobacter pylori infection, Leukocyte transendothelial migration, Tight junction
Gene Summary This gene belongs to the immunoglobulin superfamily, and the junctional adhesion molecule (JAM) family. The protein encoded by this gene is a type I membrane protein that is localized at the tight junctions of both epithelial and endothelial cells. It acts as an adhesive ligand for interacting with a variety of immune cell types, and may play a role in lymphocyte homing to secondary lymphoid organs. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2012]
Transcript Variant: This variant (3) contains an alternate 3' terminal exon compared to variant 1, which results in a frame-shift, and a longer isoform (3) with a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.