PRSS21 (NM_001270452) Human Untagged Clone

CAT#: SC332943

PRSS21 (untagged) - Homo sapiens protease, serine, 21 (testisin) (PRSS21), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PRSS21
• Synonyms: ESP-1; ESP1; TEST1; TESTISIN
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001270452, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCGCGCGCGGGGCGCTGCTGCTGGCGCTGCTGCTGGCTCGGGCTGGACTCAGGAAGCCGGAGTCGC
  AGGAGGCGGCGCCGTTATCAGGACCATGCGGCCGACGGGTCATCACGTCGCGCATCGTGGGTGGAGAGGA
  CGCCGAACTCGGGCGTTGGCCGTGGCAGGGGAGCCTGCGCCTGTGGGATTCCCACGTATGCGGAGTGAGC
  CTGCTCAGCCACCGCTGGGCACTCACGGCGGCGCACTGCTTTGAAACTGACCTTAGTGATCCCTCCGGGT
  GGATGGTCCAGTTTGGCCAGCTGACTTCCATGCCATCCTTCTGGAGCCTGCAGGCCTACTACACCCGTTA
  CTTCGTATCGAATATCTATCTGAGCCCTCGCTACCTGGGGAATTCACCCTATGACATTGCCTTGGTGAAG
  CTGTCTGCACCTGTCACCTACACTAAACACATCCAGCCCATCTGTCTCCAGGCCTCCACATTTGAGTTTG
  AGAACCGGACAGACTGCTGGGTGACTGGCTGGGGGTACATCAAAGAGGATGAGGGAAGTTCAGGTCGCCA
  TCATAAACAACTCTATGTGCAACCACCTCTTCCTCAAGTACAGTTTCCGCAAGGACATCTTTGGAGACAT
  GGTTTGTGCTGGCAATGCCCAAGGCGGGAAGGATGCCTGCTTCGGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001270452
• ORF Size: 678 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001270452.1, NP_001257381.1
• RefSeq Size: 1136
• RefSeq ORF: 678
• Locus ID: 10942
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a cell-surface anchored serine protease, which is a member of the trypsin family of serine proteases. The encoded protein is predicted to be active on peptide linkages involving the carboxyl group of lysine or arginine. The encoded protein localizes to the cytoplasm and the plasma membrane of premeiotic testicular germ cells and may be involved in progression of testicular tumors of germ cell origin. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
  Transcript Variant: This variant (4) uses two alternate splice sites in the coding region, which results in a frameshift, compared to variant 1. The encoded isoform (4) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.