Monoamine Oxidase A (MAOA) (NM_001270458) Human Untagged Clone

CAT#: SC332947

MAOA (untagged) - Homo sapiens monoamine oxidase A (MAOA), transcript variant 2


  "NM_001270458" in other vectors (2)

Reconstitution Protocol

USD 400.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "MAOA"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MAOA
Synonyms BRNRS; MAO-A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001270458, the custom clone sequence may differ by one or more nucleotides


ATGGGGAAGGAGATTCCAACTGATGCACCCTGGGAGGCTCAACATGCTGACAAATGGGACAAAATGACCA
TGAAAGAGCTCATTGACAAAATCTGCTGGACAAAGACTGCTAGGCGGTTTGCTTATCTTTTTGTGAATAT
CAATGTGACCTCTGAGCCTCACGAAGTGTCTGCCCTGTGGTTCTTGTGGTATGTGAAGCAGTGCGGGGGC
ACCACTCGGATATTCTCTGTCACCAATGGTGGCCAGGAACGGAAGTTTGTAGGTGGATCTGGTCAAGTGA
GCGAACGGATAATGGACCTCCTCGGAGACCAAGTGAAGCTGAACCATCCTGTCACTCACGTTGACCAGTC
AAGTGACAACATCATCATAGAGACGCTGAACCATGAACATTATGAGTGCAAATACGTAATTAATGCGATC
CCTCCGACCTTGACTGCCAAGATTCACTTCAGACCAGAGCTTCCAGCAGAGAGAAACCAGTTAATTCAGC
GGCTTCCAATGGGAGCTGTCATTAAGTGCATGATGTATTACAAGGAGGCCTTCTGGAAGAAGAAGGATTA
CTGTGGCTGCATGATCATTGAAGATGAAGATGCTCCAATTTCAATAACCTTGGATGACACCAAGCCAGAT
GGGTCACTGCCTGCCATCATGGGCTTCATTCTTGCCCGGAAAGCTGATCGACTTGCTAAGCTACATAAGG
AAATAAGGAAGAAGAAAATCTGTGAGCTCTATGCCAAAGTGCTGGGATCCCAAGAAGCTTTACATCCAGT
GCATTATGAAGAGAAGAACTGGTGTGAGGAGCAGTACTCTGGGGGCTGCTACACGGCCTACTTCCCTCCT
GGGATCATGACTCAATATGGAAGGGTGATTCGTCAACCCGTGGGCAGGATTTTCTTTGCGGGCACAGAGA
CTGCCACAAAGTGGAGCGGCTACATGGAAGGGGCAGTTGAGGCTGGAGAACGAGCAGCTAGGGAGGTCTT
AAATGGTCTCGGGAAGGTGACCGAGAAAGATATCTGGGTACAAGAACCTGAATCAAAGGACGTTCCAGCG
GTAGAAATCACCCACACCTTCTGGGAAAGGAACCTGCCCTCTGTTTCTGGCCTGCTGAAGATCATTGGAT
TTTCCACATCAGTAACTGCCCTGGGGTTTGTGCTGTACAAATACAAGCTCCTGCCACGGTCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001270458
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001270458.1, NP_001257387.1
RefSeq Size 5438 bp
RefSeq ORF 1185 bp
Locus ID 4128
Cytogenetics Xp11.3
Protein Families Druggable Genome
Protein Pathways Arginine and proline metabolism, Drug metabolism - cytochrome P450, Glycine, serine and threonine metabolism, Histidine metabolism, Metabolic pathways, Phenylalanine metabolism, Tryptophan metabolism, Tyrosine metabolism
Gene Summary 'This gene is one of two neighboring gene family members that encode mitochondrial enzymes which catalyze the oxidative deamination of amines, such as dopamine, norepinephrine, and serotonin. Mutation of this gene results in Brunner syndrome. This gene has also been associated with a variety of other psychiatric disorders, including antisocial behavior. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Jul 2012]'
Transcript Variant: This variant (2) contains an alternate exon in the 5' UTR and uses a downstream, in-frame start codon compared to variant 1. It encodes isoform 2 which has a shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.