LASP1 (NM_001271608) Human Untagged Clone

CAT#: SC333070

LASP1 (untagged) - Homo sapiens LIM and SH3 protein 1 (LASP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: LASP1
• Synonyms: Lasp-1; MLN50
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001271608, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTTCCATTGCGAGACCTGCAAGATGACACTGAACATGAAGAACTACAAGGGCTACGAGAAGAAGCCC
  TACTGCAACGCGTGCGCTACAAGGAGGAGTTTGAGAAGAACAAGGGCAAAGGTTTCAGCGTAGTGGCAGA
  CACGCCCGAGCTCCAGAGAATCAAGAAGACCCAGGACCAGATCAGTAACATAAAATACCATGAGGAGTTT
  GAGAAGAGCCGCATGGGCCCTAGCGGGGGCGAGGGCATGGAGCCAGAGCGTCGGGATTCACAGGACGGCA
  GCAGCTACCGGCGGCCCCTGGAGCAGCAGCAGCCTCACCACATCCCGACCAGTGCCCCGGTTTACCAGCA
  GCCCCAGCAGCAGCCGGTGGCCCAGTCCTATGGTGGCTACAAGGAGCCTGCAGCCCCAGTCTCCATACAG
  CGCAGCGCCCCAGGTGGTGGCGGGAAGCGGTACCGCGCGGTGTATGACTACAGCGCCGCCGACGAGGACG
  AGGTCTCCTTCCAGGACGGGGACACCATCGTCAACGTGCAGCAGATCGACGACGGCTGGATGTACGGGAC
  GGTGGAGCGCACCGGCGACACGGGGATGCTGCCGGCCAACTACGTGGAGGCCATCTGA
  
  
• Restriction Sites: SgfI-RsrII
• ACCN: NM_001271608
• ORF Size: 618 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001271608.1, NP_001258537.1
• RefSeq Size: 4050
• RefSeq ORF: 618
• Locus ID: 3927
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of a subfamily of LIM proteins, characterized by a LIM motif and a domain of Src homology region 3, and also a member of the nebulin family of actin-binding proteins. The encoded protein is a cAMP and cGMP dependent signaling protein and binds to the actin cytoskeleton at extensions of the cell membrane. The encoded protein has been linked to metastatic breast cancer, hematopoetic tumors such as B-cell lymphomas, and colorectal cancer. [provided by RefSeq, Oct 2012]
  Transcript Variant: This variant (2) lacks an exon in the 5' coding region compared to variant 1. This variant represents translation initiation at an alternate AUG compared to variant 1; the 5'-most initiation codon, as used in variant 1, is associated with a weak Kozak sequence and a truncated ORF that would render the transcript a candidate for nonsense-mediated decay (NMD). Leaky scanning may allow translation initiation at the downstream AUG, which results in an isoform (2) that has a distinct N-terminus and is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.