GLUT8 (SLC2A8) (NM_001271712) Human Untagged Clone

CAT#: SC333091

SLC2A8 (untagged) - Homo sapiens solute carrier family 2 (facilitated glucose transporter), member 8 (SLC2A8), transcript variant 3


  "NM_001271712" in other vectors (2)

Reconstitution Protocol

USD 320.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SLC2A8"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SLC2A8
Synonyms GLUT8; GLUTX1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001271712, the custom clone sequence may differ by one or more nucleotides


ATGGTCGTCGTCGGCATCCTCCTGGCCTACCTGGCAGGCTGGGTGCTGGAGTGGCGCTGGCTGGCTGTGC
TGGGCTGCGTGCCCCCCTCCCTCATGCTGCTTCTCATGTGCTTCATGCCCGAGACCCCGCGCTTCCTGCT
GACTCAGCACAGGCGCCAGGAGGCCATGGCCGCCCTGCGGTTCCTGTGGGGCTCCGAGCAGGGCTGGGAA
GACCCCCCCATCGGGGCTGAGCAGAGCTTTCACCTGGCCCTGCTGCGGCAGCCCGGCATCTACAAGCCCT
TCATCATCGGCGTCTCCCTGATGGCCTTCCAGCAGCTGTCGGGGGTCAACGCCGTCATGTTCTATGCAGA
GACCATCTTTGAAGAGGCCAAGTTCAAGGACAGCAGCCTGGCCTCGGTCGTCGTGGGTGTCATCCAGGTG
CTGTTCACAGCTGTGGCGGCTCTCATCATGGACAGAGCAGGGCGGAGGCTGCTCCTGGTCTTGTCAGGTG
TGGTCATGGTGTTCAGCACGAGTGCCTTCGGCGCCTACTTCAAGCTGACCCAGGGTGGCCCTGGCAACTC
CTCGCACGTGGCCATCTCGGCGCCTGTCTCTGCACAGCCTGTTGATGCCAGCGTGGGGCTGGCCTGGCTG
GCCGTGGGCAGCATGTGCCTCTTCATCGCCGGCTTTGCGGTGGGCTGGGGGCCCATCCCCTGGCTCCTCA
TGTCAGAGATCTTCCCTCTGCATGTCAAGGGCGTGGCGACAGGCATCTGCGTCCTCACCAACTGGCTCAT
GGCCTTTCTCGTGACCAAGGAGTTCAGCAGCCTCATGGAGGTCCTCAGGCCCTATGGAGCCTTCTGGCTT
GCCTCCGCTTTCTGCATCTTCAGTGTCCTTTTCACTTTGTTCTGTGTCCCTGAAACTAAAGGAAAGACTC
TGGAACAAATCACAGCCCATTTTGAGGGGCGATGA


Restriction Sites SgfI-MluI     
ACCN NM_001271712
ORF Size 945 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001271712.1, NP_001258641.1
RefSeq Size 1806
RefSeq ORF 945
Locus ID 29988
Protein Families Transmembrane
Gene Summary This gene belongs to the solute carrier 2A family, which includes intracellular glucose transporters. Based on sequence comparison, the glucose transporters are grouped into three classes and this gene is a member of class II. The encoded protein, like other members of the family, contains several conserved residues and motifs and 12 transmembrane domains with both amino and carboxyl ends being on the cytosolic side of the membrane. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]
Transcript Variant: This variant (3) lacks two alternate exons in the 5' coding region and uses a downstream start codon compared to variant 1. It encodes isoform 3 which has a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.