MRFAP1 (NM_001272053) Human Untagged Clone

CAT#: SC333194

MRFAP1 (untagged) - Homo sapiens Morf4 family associated protein 1 (MRFAP1), transcript variant 2


  "NM_001272053" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MRFAP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MRFAP1
Synonyms PAM14; PGR1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001272053, the custom clone sequence may differ by one or more nucleotides


ATGCGGCCCCTGGACATCGTCGAGCTGGCGGAACCGGAGGAAGTGGAGGTGCTGGAGCCCGAGGAGGATT
TCGAGCAGTTTCTGCTCCCGGTCATCAACGAGATGCGCGAGGACATCGCGTCGCTGACGCGCGAGCACGG
GCGGGCGTACCTGCGGAACCGGAGCAAGCTGTGGGAGATGGACAATATGCTCATCCAGATCAAAACGCAG
GTGGAGGCCTCGGAGGAGAGCGCCCTCAACCACCTCCAGAACCCGGGCGACGCGGCCGAGGGCCGGGCGG
CCAAGAGGTGCGAGAAGGCCGAGGAGAAGGCCAAGGAGATTGCGAAGATGGCAGAGATGCTGGTGGAGCT
GGTCCGGCGGATAGAGAAGAGCGAGTCGTCGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001272053
ORF Size 384 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001272053.1, NP_001258982.1
RefSeq Size 2065
RefSeq ORF 384
Locus ID 93621
Gene Summary This gene encodes an intracellular protein that interacts with members of the MORF4/MRG (mortality factor on chromosome 4/MORF4 related gene) family and the tumor suppressor Rb (retinoblastoma protein.) The protein may play a role in senescence, cell growth and immortalization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (2) uses an alternate splice site in the 5' UTR, compared to variant 1. Both variants 1 and 2 encode isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.