MRFAP1 (NM_001272054) Human Untagged Clone
CAT#: SC333195
MRFAP1 (untagged) - Homo sapiens Morf4 family associated protein 1 (MRFAP1), transcript variant 3
"NM_001272054" in other vectors (2)
Product Images
Other products for "MRFAP1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | MRFAP1 |
Synonyms | PAM14; PGR1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001272054, the custom clone sequence may differ by one or more nucleotides
ATGCGGCCCCTGGACATCGTCGAGCTGGCGGAACCGGAGGAAGTGGAGGTGCTGGAGCCCGAGGAGGATT TCGAGCAGTTTCTGCTCCCGGTCATCAACGAGATGCGCGAGGACATCGCGTCGCTGACGCGCGAGCACGG GCGGGCGTACCTGCGGAACCGGAGCAAGCTGTGGGAGATGGACAATATGCTCATCCAGATCAAAACGCAG GTGGAGGCCTCGGAGGAGAGCGCCCTCAACCACCTCCAGAACCCGGGCGACGCGGCCGAGGGCCGGGCGG CCAAGAGGTGCGAGAAGAGCGAGTCGTCGTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001272054 |
ORF Size | 312 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001272054.1, NP_001258983.1 |
RefSeq Size | 2112 |
RefSeq ORF | 312 |
Locus ID | 93621 |
Gene Summary | This gene encodes an intracellular protein that interacts with members of the MORF4/MRG (mortality factor on chromosome 4/MORF4 related gene) family and the tumor suppressor Rb (retinoblastoma protein.) The protein may play a role in senescence, cell growth and immortalization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (3) uses an alternate splice site in the 5' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.