MRFAP1 (NM_001272054) Human Untagged Clone

CAT#: SC333195

MRFAP1 (untagged) - Homo sapiens Morf4 family associated protein 1 (MRFAP1), transcript variant 3


  "NM_001272054" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MRFAP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MRFAP1
Synonyms PAM14; PGR1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001272054, the custom clone sequence may differ by one or more nucleotides


ATGCGGCCCCTGGACATCGTCGAGCTGGCGGAACCGGAGGAAGTGGAGGTGCTGGAGCCCGAGGAGGATT
TCGAGCAGTTTCTGCTCCCGGTCATCAACGAGATGCGCGAGGACATCGCGTCGCTGACGCGCGAGCACGG
GCGGGCGTACCTGCGGAACCGGAGCAAGCTGTGGGAGATGGACAATATGCTCATCCAGATCAAAACGCAG
GTGGAGGCCTCGGAGGAGAGCGCCCTCAACCACCTCCAGAACCCGGGCGACGCGGCCGAGGGCCGGGCGG
CCAAGAGGTGCGAGAAGAGCGAGTCGTCGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001272054
ORF Size 312 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001272054.1, NP_001258983.1
RefSeq Size 2112
RefSeq ORF 312
Locus ID 93621
Gene Summary This gene encodes an intracellular protein that interacts with members of the MORF4/MRG (mortality factor on chromosome 4/MORF4 related gene) family and the tumor suppressor Rb (retinoblastoma protein.) The protein may play a role in senescence, cell growth and immortalization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Transcript Variant: This variant (3) uses an alternate splice site in the 5' coding region, compared to variant 1. The encoded isoform (b) is shorter than isoform a.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.