SETMAR (NM_001276325) Human Untagged Clone

CAT#: SC333241

SETMAR (untagged) - Homo sapiens SET domain and mariner transposase fusion gene (SETMAR), transcript variant 4


  "NM_001276325" in other vectors (2)

Reconstitution Protocol

USD 370.00

5 Weeks*

Size
    • 10 ug

Product Images

Other products for "SETMAR"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SETMAR
Synonyms Mar1; METNASE
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001276325, the custom clone sequence may differ by one or more nucleotides


ATGTTCGCGGAAGCGGCAAAGACGACACGGCCTTGTGGGATGGCGGAGTTTAAGGAGAAGCCTGAGGCCC
CGACTGAGCAGCTGGATGTCGCGTGCGGCCAGGAAAACTTGCCGGTGGGCGCGTGGCCCCCGGGGGCCGC
GCCGGCGCCCTTCCAGTACACTCCTGATCATGTAGTTGGACCTGGAGCAGACATTGATCCCACTCAAATA
ACCTTTCCCGGATGCATTTGTGTCAAAACTCCCTGCCTCCCTGGCACTTGCTCCTGTCTCCGCCATGGAG
AGAACTATGATGATAACTCATGCCTTAGAGATATAGGATCTGGAGGAAAGTATGCAGAGCCTGTTTTTGA
ATGCAATGTCCTGTGCCGATGCAGTGACCACTGCAGAAACAGAGTGGTCCAGAAAGGTCTACAGTTCCAC
TTCCAAGTGTTCAAGACGCATAAAAAAGGCTGGGGACTTCGTACCTTGGAATTTATACCGAAAGGAAGGT
TTGTCTGTGAATATGCTGGTGAGGTTTTAGGATTCTCTGAAGTTCAGAGAAGAATTCACTTACAAACAAA
ATCCGACTCCAATTACATTATAGCCATCAGGGAACATGTTTATAATGGGCAGGTAATGGAAACATTTGTT
GACCCTACTTATATAGGAAATATTGGAAGATTCCTTAATCATTCTTGTGAGCCAAACCTTTTGATGATTC
CTGTCCGAATTGACTCAATGGTACCTAAGTTGGCACTTTTTGCAGCCAAAGATATTGTGCCAGAAGAAGA
ACTCTCTTATGATTATTCAGGAAGATATCTTAATCTAACAGTCAGTGAAGACAAAGAAAGGCTAGATCAT
GGGAAACTAAGGAAACCTTGTTACTGTGGTGCCAAATCATGTACTGCTTTCCTGCCTTTTGACAGTTCTC
TGTACTGCCCCGTAGAAAAGTCGAACATCAGTTGTGGAAATGAGAAGGAACCCAGCATGTGTGGCTCAGC
CCCTTCTGTGTTCCCCTCCTGCAAGCGATTGACCCTTGAGGTGAGTCTGTTCAGTGATAAGCAGCTTGCC
CCTCCCTATAGTGGAAGACAGTGGTTGGCTAGCTTTACCTCTGCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001276325
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001276325.1, NP_001263254.1
RefSeq Size 1775 bp
RefSeq ORF 1098 bp
Locus ID 6419
Cytogenetics 3p26.1
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Lysine degradation
Gene Summary 'This gene encodes a fusion protein that contains an N-terminal histone-lysine N-methyltransferase domain and a C-terminal mariner transposase domain. The encoded protein binds DNA and functions in DNA repair activities including non-homologous end joining and double strand break repair. The SET domain portion of this protein specifically methylates histone H3 lysines 4 and 36. This gene exists as a fusion gene only in anthropoid primates, other organisms lack mariner transposase domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]'
Transcript Variant: This variant (4) lacks the terminal exon and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 3 which is shorter and has a distinct C-terminus, compared to isoform 1. This isoform 3 lacks the mariner transposase domain found in isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.