USF1 (NM_001276373) Human Untagged Clone
CAT#: SC333248
USF1 (untagged) - Homo sapiens upstream transcription factor 1 (USF1), transcript variant 3
"NM_001276373" in other vectors (2)
Product Images
Other products for "USF1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | USF1 |
Synonyms | bHLHb11; FCHL; FCHL1; HYPLIP1; MLTF; MLTFI; UEF |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001276373, the custom clone sequence may differ by one or more nucleotides
ATGAAGGGGCAGCAGAAAACAGCTGAAACGGAAGAGGGGACAGTGCAGATTCAGGAAGGTGCAGTGGCTA CTGGGGAAGACCCAACCAGTGTGGCTATTGCCAGCATCCAGTCAGCTGCCACCTTCCCTGACCCCAACGT CAAGTACGTCTTCCGAACTGAGAATGGGGGCCAGGTGATGTACAGGGTGATCCAGGTGTCTGAGGGGCAG CTGGATGGCCAAACTGAGGGAACTGGCGCCATCAGTGGCTACCCTGCCACTCAATCCATGACCCAGGCGG TGATCCAGGGTGCTTTCACCAGTGATGATGCAGTTGACACGGAGGGGACAGCTGCTGAGACGCACTATAC TTACTTCCCCAGCACGGCAGTGGGAGATGGGGCAGGGGGTACCACATCGGGGAGTACAGCTGCTGTTGTT ACTACCCAGGGCTCAGAGGCACTGCTGGGGCAGGCGACCCCTCCTGGCACTGGTCAATTCTTTGTGATGA TGTCACCACAAGAAGTACTGCAGGGAGGAAGCCAGCGCTCAATTGCCCCTAGGACTCACCCTTATTCCCC GAAGTCAGAAGCTCCCCGGACGACTCGGGATGAGAAACGCAGGGCTCAGCATAATGAAGTGGAGCGTCGC CGCCGAGACAAGATCAACAACTGGATCGTGCAGCTCTCCAAGATAATCCCAGACTGCTCTATGGAGAGCA CCAAGTCTGGCCAGAGTAAAGGTGGGATTCTATCCAAAGCTTGTGATTATATCCAGGAGCTTCGGCAGAG TAACCACCGCTTGTCTGAAGAACTGCAGGGACTTGACCAACTGCAGCTGGACAATGACGTGCTTCGACAA CAGGTGGAAGATCTTAAAAACAAGAATCTGCTGCTTCGAGCTCAGTTGCGGCACCACGGATTAGAGGTCG TCATCAAGAATGACAGCAACTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001276373 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001276373.1, NP_001263302.1 |
RefSeq Size | 1734 bp |
RefSeq ORF | 933 bp |
Locus ID | 7391 |
Cytogenetics | 1q23.3 |
Protein Families | Druggable Genome, Transcription Factors |
Gene Summary | 'This gene encodes a member of the basic helix-loop-helix leucine zipper family, and can function as a cellular transcription factor. The encoded protein can activate transcription through pyrimidine-rich initiator (Inr) elements and E-box motifs. This gene has been linked to familial combined hyperlipidemia (FCHL). Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been defined on chromosome 21. [provided by RefSeq, Feb 2013]' Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Both variants 1 and 3 encode isoform 1. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.