TSC22D1 (NM_001243797) Human Untagged Clone

CAT#: SC333424

TSC22D1 (untagged) - Human TSC22 domain family, member 1 (TSC22D1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TSC22D1
• Synonyms: Ptg-2; TGFB1I4; TSC22
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243797, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATCTAGTGAAAAGCCATTTGATGTATGCGGTCAGAGAAGAAGTGGAGGTCCTCAAAGAGCAAATCA
  AAGAACTAATAGAGAAAAATTCCCAGCTGGAGCAGGAGAACAATCTGCTGAAGACACTGGCCAGTCCTGA
  GCAGCTTGCCCAGTTTCAGGCCCAGCTGCAGACTGGCTCCCCCCCTGCCACCACCCAGCCACAGGGCACC
  ACACAGCCCCCCGCCCAGCCAGCATCGCAGGGCTCAGGACCAACCGCATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243797
• ORF Size: 261 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243797.1, NP_001230726.1
• RefSeq Size: 2872
• RefSeq ORF: 261
• Locus ID: 8848
• Protein Families: Transcription Factors
• Gene Summary: This gene encodes a member of the TSC22 domain family of leucine zipper transcription factors. The encoded protein is stimulated by transforming growth factor beta, and regulates the transcription of multiple genes including C-type natriuretic peptide. The encoded protein may play a critical role in tumor suppression through the induction of cancer cell apoptosis, and a single nucleotide polymorphism in the promoter of this gene has been associated with diabetic nephropathy. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a large portion of the 5' coding region and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants 3 and 4 encode the same isoform (3), which has a significantly shorter N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.