FXYD1 (NM_001278717) Human Untagged Clone
CAT#: SC333454
FXYD1 (untagged) - Human FXYD domain containing ion transport regulator 1 (FXYD1), transcript variant c
"NM_001278717" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FXYD1 |
Synonyms | PLM |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001278717, the custom clone sequence may differ by one or more nucleotides
ATGGCGTCTCTTGGCCACATCTTGGTTTTCTGTGTGGGTCTCCTCACCATGGCCAAGGCAGAAAGTCCAA AGGAACACGACCCGTTCACTTACGACTACCAGTCCCTGCAGATCGGAGGCCTCGTCATCGCCGGGATCCT CTTCATCCTGGGCATCCTCATCGTGCTGAGCAGAAGATGCCGGTGCAAGTTCAACCAGCAGCAGAGGACT GGGGAACCCGATGAAGAGGAGGGAACTTTCCGCAGCTCCATCCGCCGTCTGTCCACCCGCAGGCGGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278717 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001278717.1, NP_001265646.1 |
RefSeq Size | 709 bp |
RefSeq ORF | 279 bp |
Locus ID | 5348 |
Cytogenetics | 19q13.12 |
Protein Families | Ion Channels: Other, Transmembrane |
Gene Summary | 'This gene encodes a member of a family of small membrane proteins that share a 35-amino acid signature sequence domain, beginning with the sequence PFXYD and containing 7 invariant and 6 highly conserved amino acids. The approved human gene nomenclature for the family is FXYD-domain containing ion transport regulator. Mouse FXYD5 has been termed RIC (Related to Ion Channel). FXYD2, also known as the gamma subunit of the Na,K-ATPase, regulates the properties of that enzyme. FXYD1 (phospholemman), FXYD2 (gamma), FXYD3 (MAT-8), FXYD4 (CHIF), and FXYD5 (RIC) have been shown to induce channel activity in experimental expression systems. Transmembrane topology has been established for two family members (FXYD1 and FXYD2), with the N-terminus extracellular and the C-terminus on the cytoplasmic side of the membrane. The protein encoded by this gene is a plasma membrane substrate for several kinases, including protein kinase A, protein kinase C, NIMA kinase, and myotonic dystrophy kinase. It is thought to form an ion channel or regulate ion channel activity. Transcript variants with different 5' UTR sequences have been described in the literature. [provided by RefSeq, Jul 2008]' Transcript Variant: This variant (c) differs in the 5' UTR compared to variant a. Variants a, b, c and d encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC235560 | FXYD1 (myc-DDK-tagged) - Human FXYD domain containing ion transport regulator 1 (FXYD1), transcript variant c |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review