DYNLRB1 (NM_001281729) Human Untagged Clone

CAT#: SC333509

DYNLRB1 (untagged) - Human dynein, light chain, roadblock-type 1 (DYNLRB1), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: DYNLRB1
• Synonyms: BITH; BLP; DNCL2A; DNLC2A; ROBLD1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001281729, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACTCACAAAGGAGAGGCCCTCATTCTTGCCTTAAAACTGCCCCTAAAGCCAAGCCTTTTCACTGGG
  AAGCCCTAGCTGCTTACCTTTTGGATACTAGCATTCCCATCAAGAGCACCATGGACAACCCCACCACCAC
  CCAGTATGCCAGCCTCATGCACAGCTTCATCCTGAAGGCACGGAGCACCGTGCGTGACATCGACCCCCAG
  AACGATCTCACCTTCCTTCGAATTCGCTCCAAGAAAAATGAAATTATGGTTGCACCAGATAAAGACTATT
  TCCTGATTGTGATTCAGAATCCAACCGAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001281729
• ORF Size: 312 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001281729.1, NP_001268658.1
• RefSeq Size: 1100
• RefSeq ORF: 312
• Locus ID: 83658
• Gene Summary: This gene is a member of the roadblock dynein light chain family. The encoded cytoplasmic protein is capable of binding intermediate chain proteins, interacts with transforming growth factor-beta, and has been implicated in the regulation of actin modulating proteins. Upregulation of this gene has been associated with hepatocellular carcinomas, suggesting that this gene may be involved in tumor progression. Alternative splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 12 and 18. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (5) differs in its 5' UTR and coding region, and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (c) has a longer and distinct N-terminus, compared to isoform a.