Diazepam Binding Inhibitor (DBI) (NM_001282633) Human Untagged Clone

CAT#: SC333523

DBI (untagged) - Human diazepam binding inhibitor (GABA receptor modulator, acyl-CoA binding protein) (DBI), transcript variant 8


  "NM_001282633" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol DBI
Synonyms ACBD1; ACBP; CCK-RP; EP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001282633, the custom clone sequence may differ by one or more nucleotides


ATGTGGGGCGACCTCTGGCTCCTCCCGCCTGCCTCTGCCAATCCGGGCACTGGGACAGAGGCTGAGTTTG
AGAAAGCTGCAGAGGAGGTTAGGCACCTTAAGACCAAGCCATCGGATGAGGAGATGCTGTTCATCTATGG
CCACTACAAACAAGCAACTGTGGGCGACATAAATACAGAACGGCCCGGGATGTTGGACTTCACGGGCAAG
GCCAAGTGGGATGCCTGGAATGAGCTGAAAGGGACTTCCAAGGAAGATGCCATGAAAGCTTACATCAACA
AAGTAGAAGAGCTAAAGAAAAAATACGGGATATGA


Restriction Sites SgfI-MluI     
ACCN NM_001282633
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282633.1, NP_001269562.1
RefSeq Size 750 bp
RefSeq ORF 315 bp
Locus ID 1622
Cytogenetics 2q14.2
Protein Families Druggable Genome
Protein Pathways PPAR signaling pathway
Gene Summary 'This gene encodes diazepam binding inhibitor, a protein that is regulated by hormones and is involved in lipid metabolism and the displacement of beta-carbolines and benzodiazepines, which modulate signal transduction at type A gamma-aminobutyric acid receptors located in brain synapses. The protein is conserved from yeast to mammals, with the most highly conserved domain consisting of seven contiguous residues that constitute the hydrophobic binding site for medium- and long-chain acyl-Coenzyme A esters. Diazepam binding inhibitor is also known to mediate the feedback regulation of pancreatic secretion and the postprandial release of cholecystokinin, in addition to its role as a mediator in corticotropin-dependent adrenal steroidogenesis. Three pseudogenes located on chromosomes 6, 8 and 16 have been identified. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]'
Transcript Variant: This variant (8) has an alternate splice site and an alternate exon in the 5' region, which results in an alternate translation start codon, compared to variant 5. The resulting isoform (1) has a shorter and distinct N-terminus, compared to isoform 5. Variants 1, 7, 8, 9, and 10 encode the same isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.