UBE2D1 (NM_001204880) Human Untagged Clone
CAT#: SC333573
UBE2D1 (untagged) - Human ubiquitin-conjugating enzyme E2D 1 (UBE2D1), transcript variant 2
"NM_001204880" in other vectors (1)
Product Images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | UBE2D1 |
| Synonyms | E2(17)KB1; SFT; UBC4/5; UBCH5; UBCH5A |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001204880, the custom clone sequence may differ by one or more nucleotides
ATGACTCCTGATAGCGCATATCAAGGTGGAGTCTTCTTTCTCACTGTACATTTTCCGACAGATTATCCTT TTAAACCACCAAAGATTGCTTTCACAACAAAAATTTACCATCCAAACATAAACAGTAATGGAAGTATTTG TCTCGATATTCTGAGGTCACAATGGTCACCAGCTCTGACTGTATCAAAAGTTTTATTGTCCATATGTTCT CTACTTTGTGATCCTAATCCAGATGACCCCTTAGTACCAGATATTGCACAAATCTATAAATCAGACAAAG AAAAATACAACAGACATGCAAGAGAATGGACTCAGAAATATGCAATGTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001204880 |
| ORF Size | 330 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001204880.1, NP_001191809.1 |
| RefSeq Size | 2648 |
| RefSeq ORF | 330 |
| Locus ID | 7321 |
| Protein Pathways | Ubiquitin mediated proteolysis |
| Gene Summary | The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is closely related to a stimulator of iron transport (SFT), and is up-regulated in hereditary hemochromatosis. It also functions in the ubiquitination of the tumor-suppressor protein p53 and the hypoxia-inducible transcription factor HIF1alpha by interacting with the E1 ubiquitin-activating enzyme and the E3 ubiquitin-protein ligases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1. The resulting isoform (2) uses a downstream start site and has a shorter and distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC235679 | UBE2D1 (myc-DDK-tagged) - Human ubiquitin-conjugating enzyme E2D 1 (UBE2D1), transcript variant 2 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review
Germany
Japan
United Kingdom
China