ZNF419A (ZNF419) (NM_001291745) Human Untagged Clone

CAT#: SC333622

ZNF419 (untagged) - Human zinc finger protein 419 (ZNF419), transcript variant 10

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNF419
• Synonyms: ZAPHIR; ZNF419A
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001291745, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGGCGGCCGCCCTGAGGGACCCCGCTCAGCAGGGCTATGTGACCTTTGAGGATGTGGCTGTCTACT
  TCTCCCAGGAGGAATGGAGATTGCTTGATGACGCTCAGAGGCTCCTCTACCGCAATGTGATGCTGGAGAA
  CTTTACACTTCTGGCCTCTCTGGGACTTGCATCTTCCAAGACCCATGAAATAACCCAGCTGGAGTCATGG
  GAGGAGCCCTTCATGCCTGCTTGGGAAGTTGTGACTTCAGCCATACCGAGAGAAACTCTGAGGATGGCCT
  TTATGAGGGAGCTGGCAATTGAACATCATTCATCTAAATATGCACACTGGAGGCAAGATGAGAATTCCTG
  A
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001291745
• ORF Size: 351 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001291745.1, NP_001278674.1
• RefSeq Size: 833
• RefSeq ORF: 351
• Locus ID: 79744
• Protein Families: Transcription Factors
• Gene Summary: May be involved in transcriptional regulation. [UniProtKB/Swiss-Prot Function]
  Transcript Variant: This variant (10) lacks an alternate in-frame exon in the 5' coding region, and it uses an alternate splice site in its 3' terminal exon and thus differs in the 3' coding region, compared to variant 1. The encoded isoform (10) has a distinct C-terminus and is shorter than isoform 1.