Calcipressin 1 (RCAN1) (NM_001285392) Human Untagged Clone

CAT#: SC333638

RCAN1 (untagged) - Human regulator of calcineurin 1 (RCAN1), transcript variant 6

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RCAN1
• Synonyms: ADAPT78; CSP1; DSC1; DSCR1; MCIP1; RCN1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001285392, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGTTATATTTTGCTCAGACCTTACACATAGGAAGCTCACACCTGGCTCCGCCAAATCCAGACAAGC
  AGTTTCTGATCTCCCCTCCCGCCTCTCCGCCAGTGGGATGGAAACAAGTGGAAGATGCGACCCCAGTCAT
  AAACTATGATCTCTTATATGCCATCTCCAAGCTGGGGCCAGGGGAAAAGTATGAATTGCACGCAGCGACT
  GACACCACTCCCAGCGTGGTGGTCCATGTATGTGAGAGTGATCAAGAGAAGGAGGAAGAAGAGGAAATGG
  AAAGAATGAGGAGACCTAAGCCAAAAATTATCCAGACCAGGAGGCCGGAGTACACGCCGATCCACCTCAG
  CTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001285392
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001285392.2, NP_001272321.1
• RefSeq Size: 2327 bp
• RefSeq ORF: 354 bp
• Locus ID: 1827
• Cytogenetics: 21q22.12
• Protein Families: Transcription Factors
• Gene Summary: 'The protein encoded by this gene interacts with calcineurin A and inhibits calcineurin-dependent signaling pathways, possibly affecting central nervous system development. This gene is located in the minimal candidate region for the Down syndrome phenotype, and is overexpressed in the brain of Down syndrome fetuses. Chronic overexpression of this gene may lead to neurofibrillary tangles such as those associated with Alzheimer disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]'
  Transcript Variant: This variant (6) uses an alternate promoter and 5' exon compared to variant 1. The resulting isoform (b) has a shorter N-terminus compared to isoform a.