RAN (NM_001300796) Human Untagged Clone

CAT#: SC333752

RAN (untagged) - Human RAN, member RAS oncogene family (RAN), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAN
• Synonyms: ARA24; Gsp1; TC4
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300796, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTTTGATGTAACATCGAGAGTTACTTACAAGAATGTGCCTAACTGGCATAGAGATCTGGTACGAGTGT
  GTGAAAACATCCCCATTGTGTTGTGTGGCAACAAAGTGGATATTAAGGACAGGAAAGTGAAGGCGAAATC
  CATTGTCTTCCACCGAAAGAAGAATCTTCAGTACTACGACATTTCTGCCAAAAGTAACTACAACTTTGAA
  AAGCCCTTCCTCTGGCTTGCTAGGAAGCTCATTGGAGACCCTAACTTGGAATTTGTTGCCATGCCTGCTC
  TCGCCCCACCAGAAGTTGTCATGGACCCAGCTTTGGCAGCACAGTATGAGCACGACTTAGAGGTTGCTCA
  GACAACTGCTCTCCCGGATGAGGATGATGACCTGTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300796
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001300796.1, NP_001287725.1
• RefSeq Size: 2492 bp
• RefSeq ORF: 387 bp
• Locus ID: 5901
• Cytogenetics: 12q24.33
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'RAN (ras-related nuclear protein) is a small GTP binding protein belonging to the RAS superfamily that is essential for the translocation of RNA and proteins through the nuclear pore complex. The RAN protein is also involved in control of DNA synthesis and cell cycle progression. Nuclear localization of RAN requires the presence of regulator of chromosome condensation 1 (RCC1). Mutations in RAN disrupt DNA synthesis. Because of its many functions, it is likely that RAN interacts with several other proteins. RAN regulates formation and organization of the microtubule network independently of its role in the nucleus-cytosol exchange of macromolecules. RAN could be a key signaling molecule regulating microtubule polymerization during mitosis. RCC1 generates a high local concentration of RAN-GTP around chromatin which, in turn, induces the local nucleation of microtubules. RAN is an androgen receptor (AR) coactivator that binds differentially with different lengths of polyglutamine within the androgen receptor. Polyglutamine repeat expansion in the AR is linked to Kennedy's disease (X-linked spinal and bulbar muscular atrophy). RAN coactivation of the AR diminishes with polyglutamine expansion within the AR, and this weak coactivation may lead to partial androgen insensitivity during the development of Kennedy's disease. [provided by RefSeq, Jul 2008]'
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The resulting isoform (2) has a shorter N-terminus, compared to isoform 1. Variants 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.