IL36 gamma (IL36G) (NM_001278568) Human Untagged Clone

CAT#: SC333823

IL36G (untagged) - Human interleukin 36, gamma (IL36G), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IL36G
• Synonyms: IL-1F9; IL-1H1; IL-1RP2; IL1E; IL1F9; IL1H1; IL1RP2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001278568, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGAGGCACTCCAGGAGACGCTGATGGTGGAGGAAGGGCCGTCTATCAATCAATCACTGTTGCTGTTA
  TCACATGCAAGTATCCAGAGGCTCTTGAGCAAGGCAGAGGGGATCCCATTTATTTGGGAATCCAGAATCC
  AGAAATGTGTTTGTATTGTGAGAAGGTTGGAGAACAGCCCACATTGCAGCTAAAAGAGCAGAAGATCATG
  GATCTGTATGGCCAACCCGAGCCCGTGAAACCCTTCCTTTTCTACCGTGCCAAGACTGGTAGGACCTCCA
  CCCTTGAGTCTGTGGCCTTCCCGGACTGGTTCATTGCCTCCTCCAAGAGAGACCAGCCCATCATTCTGAC
  TTCAGAACTTGGGAAGTCATACAACACTGCCTTTGAATTAAATATAAATGACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001278568
• ORF Size: 405 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001278568.1, NP_001265497.1
• RefSeq Size: 1107
• RefSeq ORF: 405
• Locus ID: 56300
• Protein Families: Druggable Genome, Secreted Protein
• Gene Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. The activity of this cytokine is mediated by interleukin 1 receptor-like 2 (IL1RL2/IL1R-rp2), and is specifically inhibited by interleukin 1 family, member 5 (IL1F5/IL-1 delta). Interferon-gamma, tumor necrosis factor-alpha and interleukin 1, beta (IL1B) are reported to stimulate the expression of this cytokine in keratinocytes. The expression of this cytokine in keratinocytes can also be induced by a contact hypersensitivity reaction or herpes simplex virus infection. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, May 2019]
  Transcript Variant: This variant (2) lacks an in-frame exon in the 5' region, compared to variant 1. The resulting isoform (2) lacks an internal segment, compared to isoform 1.