CIB3 (NM_001300922) Human Untagged Clone

CAT#: SC333859

CIB3 (untagged) - Human calcium and integrin binding family member 3 (CIB3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CIB3
• Synonyms: KIP3
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001300922, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGGCAACAAGCAGACAGTCTTCACACACGAGCAGCTGGAAGCGTATCAGGACAACCCCTTCCGCCAGA
  GGATTGCCCAGGTATTCTCTGAGGATGGGGATGGCCACATGACCCTGGACAACTTTTTGGACATGTTTTC
  CGTGATGAGTGAAATGGCTCCCCGCGACCTCAAGGCTTACTATGCTTTTAAAATTTATGATTTTAACAAC
  GACGACTACATTTGTGCGTGGGACCTGGAGCAGACGGTGACCAAACTGACGCGGGGGGGGCTGAGTGCCG
  AGGAGGTGAGCCTGGTATGTGAGAAGGTGCTGGATGAGGCTGATGGAGACCATGATGGGCGGCTGTCCCT
  GGAAGATTTCCAGAACATGATCCTCCGGGCACCAGACTTCCTCAGCACCTTCCACATCCGAATCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001300922
• ORF Size: 417 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001300922.1, NP_001287851.1
• RefSeq Size: 578
• RefSeq ORF: 417
• Locus ID: 117286
• Protein Families: Druggable Genome
• Gene Summary: This gene product shares a high degree of sequence similarity with DNA-dependent protein kinase catalytic subunit-interacting protein 2 in human and mouse, and like them may bind the catalytic subunit of DNA-dependent protein kinases. The exact function of this gene is not known. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
  Transcript Variant: This variant (2) lacks two consecutive alternate exons in the 5' coding region, compared to variant 1. It encodes isoform 2, which lacks an internal in-frame segment and is shorter, compared to isoform 1.