CST8 (NM_001281730) Human Untagged Clone

CAT#: SC333889

CST8 (untagged) - Human cystatin 8 (cystatin-related epididymal specific) (CST8), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CST8
• Synonyms: CRES; CTES5
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001281730, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCCCAGGTGCCGGTGGCTCTCCCTGATCCTCCTCACCATTCCCCTGGCCCTGGTGGCCAGGAAAGACC
  CAAAAAAGAATGAGACAGGGGTGCTGAGGAAATTAAAACCCGTCAATGCCTCAAATGCCAACGTGAAGCA
  GTGTCTGTGGTTTGCCATGCAAGAATACAACAAAGAGAGCGAGGACAAGTATGTCTTCCTGGTGGTCAAG
  ACACTGCAAGCCCAGCTTCAGGTCACAAATCTTCTGGAATACCTTATTGATGTAGAAATTGCCCGCAGCG
  ATTGCAGAAAGCCTTTAAGCACTAATGAAATCTGCGCCATTCAAGAAAACTCCAAGCTGAAAAGGAAATT
  AAGCTGCAGCTTTTTGGTAGGAGCACTTCCCTGGAATGGTGAATTCACTGTGATGGAGAAAAAGTGTGAA
  GATGCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001281730
• ORF Size: 429 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001281730.1, NP_001268659.1
• RefSeq Size: 764
• RefSeq ORF: 429
• Locus ID: 10047
• Protein Families: Secreted Protein
• Gene Summary: The cystatin superfamily encompasses proteins that contain multiple cystatin-like sequences. Some of the members are active cysteine protease inhibitors, while others have lost or perhaps never acquired this inhibitory activity. There are three inhibitory families in the superfamily, including the type 1 cystatins (stefins), type 2 cystatins and the kininogens. The type 2 cystatin proteins are a class of cysteine proteinase inhibitors found in a variety of human fluids and secretions. The cystatin locus on chromosome 20 contains the majority of the type 2 cystatin genes and pseudogenes. This gene is located in the cystatin locus and encodes a protein similar to type 2 cystatins. The encoded protein exhibits highly tissue-specific expression in the reproductive tract, suggesting implicit roles in reproduction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein.