TPD52 (NM_001287144) Human Untagged Clone

CAT#: SC333924

TPD52 (untagged) - Human tumor protein D52 (TPD52), transcript variant 7


  "NM_001287144" in other vectors (1)

Reconstitution Protocol

USD 310.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "TPD52"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol TPD52
Synonyms D52; hD52; N8L; PC-1; PrLZ
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001287144, the custom clone sequence may differ by one or more nucleotides


ATGGACCGCGGCGAGCAAGGTCTGCTGAGAACAGACCCAGTCCCTGAGGAAGGAGAAGATGTTGCTGCCA
CGATCAGTGCCACAGAGACCCTCTCGGAAGAGGAGCAGGAAGAGCTAAGAAGAGAACTTGCAAAGGTAGA
AGAAGAAATCCAGACTCTGTCTCAAGTGTTAGCAGCAAAAGAGAAGCATCTAGCAGAGATCAAGCGGAAA
CTTGGAATCAATTCTCTACAGGAACTAAAACAGAACATTGCCAAAGGGTGGCAAGACGTGACAGCAACAT
CTGCTTACAAGAAGACATCTGAAACCTTATCCCAGGCTGGACAGAAGGCCTCAGCTGCTTTTTCGTCTGT
TGGCTCAGTCATCACCAAAAAGCTGGAAGATGTAAAAAACTCCCCAACTTTTAAATCATTTGAAGAAAAG
GTCGAAAACTTAAAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001287144
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001287144.1, NP_001274073.1
RefSeq Size 4024 bp
RefSeq ORF 438 bp
Locus ID 7163
Cytogenetics 8q21.13
Gene Summary ''
Transcript Variant: This variant (7) contains an alternate 5' terminal exon and it thus differs in its 5' UTR and 5' coding region, it lacks two alternate in-frame exons in the central coding region, and it uses an alternate splice site that results in an early stop codon, compared to variant 4. The encoded isoform (7) has a distinct N-terminus and is shorter than isoform 4.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.