RGS20 (NM_001286674) Human Untagged Clone

CAT#: SC333988

RGS20 (untagged) - Human regulator of G-protein signaling 20 (RGS20), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RGS20
• Synonyms: g(z)GAP; gz-GAP; RGSZ1; ZGAP1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001286674, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAAGGAGACCTCAGGGCTGTTCCTGATATCAAGCCCTGCTCCTACTCTGGAAGAAGTCAACGCCTGGG
  CTCAGTCATTTGACAAATTAATGGTCACTCCAGCAGGAAGGAATGCATTCCGTGAATTCCTCCGAACAGA
  ATTCAGTGAGGAAAATATGCTCTTCTGGATGGCCTGTGAGGAACTGAAAAAGGAAGCTAATAAAAACATT
  ATTGAAGAGAAAGCAAGGATAATCTATGAAGACTACATTTCTATACTTTCTCCTAAGGAGGTGAGCTTAG
  ACTCCCGGGTGAGAGAAGTGATCAACAGAAACATGGTGGAGCCATCCCAACACATATTCGATGATGCTCA
  ACTTCAGATTTACACCCTGATGCACAGAGACTCATATCCTCGATTCATGAACTCTGCTGTCTATAAGGAC
  TTGCTTCAGTCCTTATCGGAGAAATCTATTGAAGCATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001286674
• ORF Size: 459 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001286674.1, NP_001273603.1
• RefSeq Size: 1527
• RefSeq ORF: 459
• Locus ID: 8601
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene belongs to the family of regulator of G protein signaling (RGS) proteins, which are regulatory and structural components of G protein-coupled receptor complexes. RGS proteins inhibit signal transduction by increasing the GTPase activity of G protein alpha subunits, thereby driving them into their inactive GDP-bound forms. This protein selectively binds to G(z)-alpha and G(alpha)-i2 subunits, and regulates their signaling activities. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
  Transcript Variant: This variant (4) lacks three in-frame exons in the central coding region which results in the use of an alternate start codon compared to variant 1. The encoded isoform (d) is shorter and has a distinct N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.