RANTES (CCL5) (NM_001278736) Human Untagged Clone

CAT#: SC334003

CCL5 (untagged) - Human chemokine (C-C motif) ligand 5 (CCL5), transcript variant 2


  "NM_001278736" in other vectors (1)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "CCL5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCL5
Synonyms D17S136E; eoCP; RANTES; SCYA5; SIS-delta; SISd; TCP228
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001278736, the custom clone sequence may differ by one or more nucleotides


ATGAAGGTCTCCGCGGCAGCCCTCGCTGTCATCCTCATTGCTACTGCCCTCTGCGCTCCTGCATCTGCCT
CCCCATATTCCTCGGACACCACACCCTGCTGCTTTGCCTACATTGCCCGCCCACTGCCCCGTGCCCACAT
CAAGGAGTATTTCTACACCAGTGGCAAGTGCTCCAACCCAGCAGTCGTCCACAGGTCAAGGATGCCAAAG
AGAGAGGGACAGCAAGTCTGGCAGGATTTCCTGTATGACTCCCGGCTGAACAAGGGCAAGCTTTGTCACC
CGAAAGAACCGCCAAGTGTGTGCCAACCCAGAGAAGAAATGGGTTCGGGAGTACATCAACTCTTTGGAGA
TGAGCTAGGATGGAGAGTCCTTGAACCTGAACTTACACAAATTTGCCTGTTTCTGCTTGCTCTTGTCCTA
GCTTGGGAGGCTTCCCCTCACTATCCTACCCCACCCGCTCCTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001278736
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001278736.1, NP_001265665.1
RefSeq Size 1319 bp
RefSeq ORF 465 bp
Locus ID 6352
Cytogenetics 17q12
Protein Families Druggable Genome, Secreted Protein, Transmembrane
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction, Cytosolic DNA-sensing pathway, Epithelial cell signaling in Helicobacter pylori infection, NOD-like receptor signaling pathway, Prion diseases, Toll-like receptor signaling pathway
Gene Summary 'This gene is one of several chemokine genes clustered on the q-arm of chromosome 17. Chemokines form a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of the N-terminal cysteine residues of the mature peptide. This chemokine, a member of the CC subfamily, functions as a chemoattractant for blood monocytes, memory T helper cells and eosinophils. It causes the release of histamine from basophils and activates eosinophils. This cytokine is one of the major HIV-suppressive factors produced by CD8+ cells. It functions as one of the natural ligands for the chemokine receptor chemokine (C-C motif) receptor 5 (CCR5), and it suppresses in vitro replication of the R5 strains of HIV-1, which use CCR5 as a coreceptor. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]'
Transcript Variant: This variant (2) uses an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (2) has a longer and distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.