PMP22 (NM_001281456) Human Untagged Clone

CAT#: SC334064

PMP22 (untagged) - Human peripheral myelin protein 22 (PMP22), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PMP22
• Synonyms: CIDP; CMT1A; CMT1E; DSS; GAS-3; GAS3; HMSNIA; HNPP; Sp110
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001281456, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGCTCCTCCTGTTGCTGAGTATCATCGTCCTCCACGTCGCGGTGCTGGTGCTGCTGTTCGTCTCCACGA
  TCGTCAGCCAATGGATCGTGGGCAATGGACACGCAACTGATCTCTGGCAGAACTGTAGCACCTCTTCCTC
  AGGAAATGTCCACCACTGTTTCTCATCATCACCAAACGAATGGCTGCAGTCTGTCCAGGCCACCATGATC
  CTGTCGATCATCTTCAGCATTCTGTCTCTGTTCCTGTTCTTCTGCCAACTCTTCACCCTCACCAAGGGGG
  GCAGGTTTTACATCACTGGAATCTTCCAAATTCTTGCTGGTCTGTGCGTGATGAGTGCTGCGGCCATCTA
  CACGGTGAGGCACCCGGAGTGGCATCTCAACTCGGATTACTCCTACGGTTTCGCCTACATCCTGGCCTGG
  GTGGCCTTCCCCCTGGCCCTTCTCAGCGGTGTCATCTATGTGATCTTGCGGAAACGCGAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001281456
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001281456.1, NP_001268385.1
• RefSeq Size: 1857 bp
• RefSeq ORF: 483 bp
• Locus ID: 5376
• Cytogenetics: 17p12
• Protein Families: Transmembrane
• Gene Summary: 'This gene encodes an integral membrane protein that is a major component of myelin in the peripheral nervous system. Studies suggest two alternately used promoters drive tissue-specific expression. Various mutations of this gene are causes of Charcot-Marie-Tooth disease Type IA, Dejerine-Sottas syndrome, and hereditary neuropathy with liability to pressure palsies. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]'
  Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 1. Variants 1-5 encode the same isoform (1).