ZNRD2 (NM_001303024) Human Untagged Clone

CAT#: SC334080

SSSCA1 (untagged) - Human Sjogren syndrome/scleroderma autoantigen 1 (SSSCA1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ZNRD2
• Synonyms: p27; SSSCA1
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001303024, the custom clone sequence may differ by one or more nucleotidesGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGGCGACTATCTGCTGCGCGGTTACCGCATGCTGGGCGAGACGTGTGCGGACTGCGGGACGATCCTC
  CTCCAAGACAAACAGCGGAAAATCTACTGCGTGGCTTGTCAGGAACTCGACTCAGACGTGGATAAAGAT
  AATCCCGCTCTGAATGCCCAGGCTGCCCTCTCCCAAGCTCGGGAGCACCAGCTGGCCTCAGCCTCAGAG
  CTCCCCCTGGGCTCTCGACCTGCGCCCCAGCCCCCAGTACCTCGTCCGGAGCACTGTGAGGGAGCTGCA
  GCAGGACTCAAGGCAGCCCAGGGGCCACCTGCTCCTGCTGTGCCTCCAAATACAGATGTCATGGCCTGC
  ACACAGACAGCCCTCTTGCAGAAGCTGACCTGGGCCTCTGCTGAACTGGGCTCTAGCACCTCCCTGGAG
  ACTAGCATCCAGCTGTGTGGCCTTATCCGCGCATGTGCGGAGGCCCTGCGCAGCCTGCAGCAGCTACAG
  CACTAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001303024
• Insert Size: 489 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001303024.2
• RefSeq Size: 862 bp
• RefSeq ORF: 489 bp
• Locus ID: 10534
• Cytogenetics: 11q13.1
• MW: 17.2 kDa
• Gene Summary: This antigen is recognized by a subset of anti-centromere antibodies from patients with scleroderma and/or Sjogren's syndrome. Subcellular localization has not yet been established. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus compared to isoform 1.