ZNRD2 (NM_001303024) Human Untagged Clone

CAT#: SC334080

SSSCA1 (untagged) - Human Sjogren syndrome/scleroderma autoantigen 1 (SSSCA1), transcript variant 2


  "NM_001303024" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
SSSCA1 mouse monoclonal antibody, clone OTI2F5 (formerly 2F5)
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "ZNRD2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ZNRD2
Synonyms p27; SSSCA1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001303024, the custom clone sequence may differ by one or more nucleotidesGCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCGACTATCTGCTGCGCGGTTACCGCATGCTGGGCGAGACGTGTGCGGACTGCGGGACGATCCTC
CTCCAAGACAAACAGCGGAAAATCTACTGCGTGGCTTGTCAGGAACTCGACTCAGACGTGGATAAAGAT
AATCCCGCTCTGAATGCCCAGGCTGCCCTCTCCCAAGCTCGGGAGCACCAGCTGGCCTCAGCCTCAGAG
CTCCCCCTGGGCTCTCGACCTGCGCCCCAGCCCCCAGTACCTCGTCCGGAGCACTGTGAGGGAGCTGCA
GCAGGACTCAAGGCAGCCCAGGGGCCACCTGCTCCTGCTGTGCCTCCAAATACAGATGTCATGGCCTGC
ACACAGACAGCCCTCTTGCAGAAGCTGACCTGGGCCTCTGCTGAACTGGGCTCTAGCACCTCCCTGGAG
ACTAGCATCCAGCTGTGTGGCCTTATCCGCGCATGTGCGGAGGCCCTGCGCAGCCTGCAGCAGCTACAG
CACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001303024
Insert Size 489 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001303024.2
RefSeq Size 862 bp
RefSeq ORF 489 bp
Locus ID 10534
Cytogenetics 11q13.1
MW 17.2 kDa
Gene Summary This antigen is recognized by a subset of anti-centromere antibodies from patients with scleroderma and/or Sjogren's syndrome. Subcellular localization has not yet been established. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.