CIRBP (NM_001300815) Human Untagged Clone
CAT#: SC334118
CIRBP (untagged) - Human cold inducible RNA binding protein (CIRBP), transcript variant 4
"NM_001300815" in other vectors (1)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CIRBP |
Synonyms | CIRP |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001300815, the custom clone sequence may differ by one or more nucleotides
ATGGCATCAGATGAAGGCAAACTTTTTGTTGGAGGGCTGAGTTTTGACACCAATGAGCAGTCGCTGGAGC AGGTCTTCTCAAAGTACGGACAGATCTCTGAAGTGGTGGTTGTGAAAGACAGGGAGACCCAGAGATCTCG GGGATTTGGGTTTGTCACCTTTGAGAACATTGACGACGCTAAGGATGCCATGATGGCCATGAATGGGAAG TCTGTAGATGGACGGCAGATCCGAGTAGACCAGGCAGGCAAGTCGTCAGACAACCGATCCCGTGGGTACC GTGGTGGCTCTGCCGGGGGCCGGGGCTTCTTCCGTGGGGGCCGAGGACGGGGCCGTGGGTTCTCTAGAGG AGGAGGGGACCGAGGCTATGGGGGGAACCGGTTCGAGTCCAGGAGTGGGGGCTACGGAGGCTCCAGAGAC TACTATAGCAGCCGGAGTCAGAGTGGTGGCTACAGTGACCGGAGCTCGGGCGGGTCCTACAGAGACAGTT ATGACAGTTACGGTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001300815 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001300815.1, NP_001287744.1 |
RefSeq Size | 1170 bp |
RefSeq ORF | 507 bp |
Locus ID | 1153 |
Cytogenetics | 19p13.3 |
Gene Summary | '' Transcript Variant: This variant (4) contains an alternate 3' terminal exon, resulting in a novel 3' coding region and 3' UTR, compared to variant 5. It encodes isoform 2, which has a shorter and distinct C-terminus, compared to isoform 3. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC236224 | CIRBP (myc-DDK-tagged) - Human cold inducible RNA binding protein (CIRBP), transcript variant 4 |
USD 420.00 |
{0} Product Review(s)
Be the first one to submit a review