EFCAB2 (NM_001290327) Human Untagged Clone

CAT#: SC334153

EFCAB2 (untagged) - Human EF-hand calcium binding domain 2 (EFCAB2), transcript variant 5


  "NM_001290327" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Other products for "EFCAB2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol EFCAB2
Synonyms CFAP200; DRC8
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334153 representing NM_001290327.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAAGGTGGAAGAAGAGACCATCACACAATGACGGTGTTATGGGGAACACAGGAGATAATAGTAGCA
GAATTTCACAAAAAAATCAAAGAGGCATTTGAAGTCTTTGACCATGAGTCGAATAATACAGTGGATGTG
AGAGAGATTGGAACAATTATCAGGTCATTAGGATGCTGTCCTACGGAAGGAGAGCTGCATGATCTGATT
GCAGAGGTAGAGGAAGAAGAACCCACTGGATACATTCGATTCGAAAAATTTCTTCCGGTGATGACAGAA
ATACTACTAGAAAGAAAATACAGACCAATTCCAGAAGATGTCCTTCTTCGAGCTTTTGAGGTTTTAGAT
TCAGCTAAACGTGGGTTTCTTACTAAGGACGAGCTGATCAAGTATATGACTGAAGAAGGTGAGCCTTTT
TCTCAAGAGGAAATGGAAGAAATGTTGTCTGCTGCAATTGATCCAGAATCAAATTCAATTAATTACAAG
GACTATATAACAATGATGGTGATAGATGAAAATTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001290327
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001290327.1
RefSeq Size 1177 bp
RefSeq ORF 519 bp
Locus ID 84288
Cytogenetics 1q44
MW 20 kDa
Gene Summary The gene encodes a protein that contains two EF-hand calcium-binding domains although its function has yet to be determined. Alternatively spliced transcripts have been observed. [provided by RefSeq, Mar 2014]
Transcript Variant: This variant (5) includes in alternate exon, lacks a portion of the 5' coding region, and initiates translation at an alternate start codon, compared to variant 2. The resulting protein (isoform c) is longer and has a distinct N-terminus compared to isoform b. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.