FUSIP1 (SRSF10) (NM_001300936) Human Untagged Clone

CAT#: SC334159

SRSF10 (untagged) - Human serine/arginine-rich splicing factor 10 (SRSF10), transcript variant 8


  "NM_001300936" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
Rabbit Polyclonal Anti-FUSIP1 Antibody
    • 100 ul

USD 475.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "SRSF10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SRSF10
Synonyms FUSIP1; FUSIP2; NSSR; PPP1R149; SFRS13; SFRS13A; SRp38; SRrp40; TASR; TASR1; TASR2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334159 representing NM_001300936.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCCCGCTACCTGCGTCCCCCCAACACGTCTCTGTTCGTCAGGAACGTGGCCGACGACACCAGGTCT
GAAGACTTGCGGCGTGAATTTGGTCGTTATGGTCCTATAGTTGATGTGTATGTTCCACTTGATTTCTAC
ACTCGCCGTCCAAGAGGATTTGCTTATGTTCAATTTGAGGATGTTCGTGATGCTGAAGACGCTTTACAT
AATTTGGACAGAAAGTGGATTTGTGGACGGCAGATTGAAATACAGTTTGCCCAGGGGGATCGAAAGACA
CCAAATCAGATGAAAGCCAAGGAAGGGAGGAATGTGTACAGTTCTTCACGCTATGATGATTATGACAGA
TACAGACGTTCTAGAAGCCGAAGTTATGAAAGGAGGAGATCAAGAAGTCGGTCTTTTGATTACAACTAT
AGAAGATCGTATAGTCCTAGAAATAGACCGACTGGAAGACCACGGCGTAGCAGAAGCCATTCCGACAAT
GATAGCCAAGTAAGCAAGAAGAAAAATGAGAGATAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001300936
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001300936.1
RefSeq Size 4306 bp
RefSeq ORF 519 bp
Locus ID 10772
Cytogenetics 1p36.11
Protein Families Transcription Factors
Protein Pathways Spliceosome
MW 20.9 kDa
Gene Summary This gene product is a member of the serine-arginine (SR) family of proteins, which are involved in constitutive and regulated RNA splicing. Members of this family are characterized by N-terminal RNP1 and RNP2 motifs, which are required for binding to RNA, and multiple C-terminal SR/RS repeats, which are important in mediating association with other cellular proteins. This protein interacts with the oncoprotein TLS, and abrogates the influence of TLS on adenovirus E1A pre-mRNA splicing. This gene has pseudogenes on chromosomes 4, 9, 14, 18, and 20. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Transcript Variant: This variant (8) uses an alternate in-frame splice site and lacks an alternate segment in the 3' coding region, which results in a frameshift, compared to variant 2. The encoded isoform (8) has a distinct C-terminus and is shorter than isoform 2. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.