Adenosine A3 Receptor (ADORA3) (NM_001302679) Human Untagged Clone

CAT#: SC334162

ADORA3 (untagged) - Human adenosine A3 receptor (ADORA3), transcript variant C

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ADORA3
• Synonyms: A3AR
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334162 representing NM_001302679.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGTTTGGCTGGAACATGAAACTGACCTCAGAGTACCACAGAAATGTCACCTTCCTTTCATGCCAATTT
  GTTTCCGTCATGAGAATGGACTACATGGTATACTTCAGCTTCCTCACCTGGATTTTCATCCCCCTGGTT
  GTCATGTGCGCCATCTATCTTGACATCTTTTACATCATTCGGAACAAACTCAGTCTGAACTTATCTAAC
  TCCAAAGAGACAGGTGCATTTTATGGACGGGAGTTCAAGACGGCTAAGTCCTTGTTTCTGGTTCTTTTC
  TTGTTTGCTCTGTCATGGCTGCCTTTATCTATCATCAACTGCATCATCTACTTTAATGGTGAGGTACCA
  CAGCTTGTGCTGTACATGGGCATCCTGCTGTCCCATGCCAACTCCATGATGAACCCTATCGTCTATGCC
  TATAAAATAAAGAAGTTCAAGGAAACCTACCTTTTGATCCTCAAAGCTTGTGTGGTCTGCCATCCCTCT
  GATTCTTTGGACACAAGCATTGAGAAGAATTCTGAGTAG
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001302679
• Insert Size: 522 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001302679.1
• RefSeq Size: 1767 bp
• RefSeq ORF: 522 bp
• Locus ID: 140
• Cytogenetics: 1p13.2
• Protein Families: Druggable Genome, GPCR, Transmembrane
• Protein Pathways: Neuroactive ligand-receptor interaction
• MW: 20.2 kDa
• Gene Summary: This gene encodes a protein that belongs to the family of adenosine receptors, which are G-protein-coupled receptors that are involved in a variety of intracellular signaling pathways and physiological functions. The receptor encoded by this gene mediates a sustained cardioprotective function during cardiac ischemia, it is involved in the inhibition of neutrophil degranulation in neutrophil-mediated tissue injury, it has been implicated in both neuroprotective and neurodegenerative effects, and it may also mediate both cell proliferation and cell death. Alternative splicing results in multiple transcript variants. This gene shares its 5' terminal exon with some transcripts from overlapping GeneID:57413, which encodes an immunoglobulin domain-containing protein. [provided by RefSeq, Nov 2014]
  Transcript Variant: This variant (C) uses an alternate splice site in the 5' terminal exon, and it thus differs in its 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant A. The encoded isoform (C) is shorter at the N-terminus, compared to isoform A. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.