CBR1 (NM_001286789) Human Untagged Clone

CAT#: SC334170

CBR1 (untagged) - Human carbonyl reductase 1 (CBR1), transcript variant 2


  "NM_001286789" in other vectors (1)

Reconstitution Protocol

USD 477.00

2 Weeks*

Size
    • 10 ug

Product Images

Frequently bought together (2)
CBR1 mouse monoclonal antibody,clone OTI4B4
    • 100 ul

USD 379.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

USD 430.00

Other products for "CBR1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CBR1
Synonyms CBR; hCBR1; PG-9-KR; SDR21C1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC334170 representing NM_001286789.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGTCCGGCATCCATGTAGCGCTGGTGACTGGAGGCAACAAGGGCATCGGCTTGGCCATCGTGCGC
GACCTGTGCCGGCTGTTCTCGGGGGACGTGGTGCTCACGGCGCGGGACGTGACGCGGGGCCAGGCGGCC
GTACAGCAGCTGCAGGCGGAGGGCCTGAGCCCGCGCTTCCACCAGCTGGACATCGACGATCTGCAGAGC
ATCCGCGCCCTGCGCGACTTCCTGCGCAAGGAGTACGGGGGCCTGGACGTGCTGGTCAACAACGCGGGC
ATCGCCTTCAAGGTTGCTGATCCCACACCCTTTCATATTCAAGCTGAAGTGACGATGAAAACAAATTTC
TTTGGTACCCGAGATGTGTGCACAGAATTACTCCCTCTAATAAAACCCCAAGCATCCTGCGTACTGTCT
GCATGGTCATGCCTCTCCCAAAATCCTTCAGGAGGAAAGTCCAAGCCCTTAGCATGGTTCACAGAGATG
TCCATAATCTGCCGCTGCTTAACTCTGGGCCCATTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI      Plasmid Map     
ACCN NM_001286789
Insert Size 522 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286789.1
RefSeq Size 1952 bp
RefSeq ORF 522 bp
Locus ID 873
UniProt ID P16152
Cytogenetics 21q22.12
Protein Families Druggable Genome
Protein Pathways Arachidonic acid metabolism, Metabolic pathways
MW 18.8 kDa
Gene Summary The protein encoded by this gene belongs to the short-chain dehydrogenases/reductases (SDR) family, which function as NADPH-dependent oxidoreductases having wide specificity for carbonyl compounds, such as quinones, prostaglandins, and various xenobiotics. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (2) uses an alternate acceptor splice site at the 3' terminal exon that causes a frame-shift compared to variant 1. The resulting shorter isoform (2) has a distinct C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.