POLR2H (NM_001278698) Human Untagged Clone

CAT#: SC334182

POLR2H (untagged) - Human polymerase (RNA) II (DNA directed) polypeptide H (POLR2H), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: POLR2H
• Synonyms: RPABC3; RPB8; RPB17
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334182 representing NM_001278698.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGGCGGGCATCCTGTTTGAGGATATTTTCGATGTGAAGGATATTGACCCGGAGGGCAAGAAGTTTGAC
  CGAGTGTCTCGACTGCATTGTGAGAGTGAATCTTTCAAGATGGATCTAATCTTAGATGTAAACATTCAA
  ATTTACCCTGTAGACTTGGGTGACAAGTTTCGGTTGGTCATAGCTAGTACCTTGTATGAAGATGGTACC
  CTGGATGATGGTGAATACAACCCCACTGATGATAGGCCTTCCAGGGCTGACCAGTTTGAGTATGTAATG
  TATGGAAAAGTGTACAGGATTGAGGGAGATGAAACTTCTACTGAAGCAGCAACACGCCTGCTGAGATTG
  AGAGCTGCTGAGTGGCAGTGCTCCAGAATCACGGGATGGGGCCTTCTGTTTCAGCTCTGCGTACGTGTC
  CTATGGGGGCCTGCTCATGAGGCTGCAGGGGGATGCCAACAACCTGCATGGATTCGAGGTGGACTCCAG
  AGTTTATCTCCTGATGAAGAAGCTAGCCTTCTGAACCTCGCCTGA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001278698
• Insert Size: 528 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001278698.1
• RefSeq Size: 1328 bp
• RefSeq ORF: 528 bp
• Locus ID: 5437
• UniProt ID: P52434
• Cytogenetics: 3q27.1
• Protein Families: Transcription Factors
• Protein Pathways: Huntington's disease, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
• MW: 19.8 kDa
• Gene Summary: The three eukaryotic RNA polymerases are complex multisubunit enzymes that play a central role in the transcription of nuclear genes. This gene encodes an essential and highly conserved subunit of RNA polymerase II that is shared by the other two eukaryotic DNA-directed RNA polymerases, I and III. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
  Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).