RSPO2 (NM_001282863) Human Untagged Clone

CAT#: SC334211

RSPO2 (untagged) - Human R-spondin 2 (RSPO2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RSPO2
• Synonyms: CRISTIN2; HHRRD; TETAMS2
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >SC334211 representing NM_001282863.
  Blue=Insert sequence Red=Cloning site Green=Tag(s)
  
  GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
  GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
  ATGCAGTTTCGCCTTTTCTCCTTTGCCCTCATCATTCTGAACTGCATGGATTACAGCCACTGCCAAGGC
  AACCGATGGAGACGCAGTAAGCGAGGATGCAGAATAGAAAACTGTGATTCTTGCTTTAGCAAAGACTTT
  TGTACCAAGTGCAAAGTAGGCTTTTATTTGCATAGAGGCCGTTGCTTTGATGAATGTCCAGATGGTTTT
  GCACCATTAGAAGAAACCATGGAATGTGTGGGATGTGAAGTTGGTCATTGGAGCGAATGGGGAACTTGT
  AGCAGAAATAATCGCACATGTGGATTTAAATGGGGTCTGGAAACCAGAACACGGCAAATTGTTAAAAAG
  CCAGTGAAAGACACAATACTGTGTCCAACCATTGCTGAATCCAGGAGATGCAAGATGACAATGAGGCAT
  TGTCCAGGAGGGAAGAGAACACCAAAGGCGAAGGAGAAGAGGAACAAGAAAAAGAAAAGGAAGCTGATA
  GAAAGGGCCCAGGAGCAACACAGCGTCTTCCTAGCTACAGACAGAGCTAACCAATAA
  ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
  TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC
  
• Restriction Sites: SgfI-MluI Plasmid Map
• ACCN: NM_001282863
• Insert Size: 540 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001282863.1
• RefSeq Size: 2777 bp
• RefSeq ORF: 540 bp
• Locus ID: 340419
• UniProt ID: Q6UXX9
• Cytogenetics: 8q23.1
• Protein Families: Secreted Protein
• MW: 21 kDa
• Gene Summary: This gene encodes a member of the R-spondin family of proteins. These proteins are secreted ligands of leucine-rich repeat containing G protein-coupled receptors that enhance Wnt signaling through the inhibition of ubiquitin E3 ligases. A chromosomal translocation including this locus that results in the formation of a gene fusion has been identified in multiple human cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
  Transcript Variant: This variant (2) difers in the 5' UTR and lacks an in-frame exon in the central coding region compare to variant 1. The encoded isoform (2) is shorter than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.